Article Versions
Export Article
Cite this article
  • Normal Style
  • MLA Style
  • APA Style
  • Chicago Style
Research Article
Open Access Peer-reviewed

Microbiological Analysis and Molecular Characterization of Bacterial and Fungal Isolates Present in Exposed and Packaged Cassava, Plantain and Yam Flour Sold in Selected Markets in Port Harcourt, Rivers State, Nigeria

Ngozi Nma Odu, Ndukwe Maduka
American Journal of Microbiological Research. 2019, 7(2), 63-72. DOI: 10.12691/ajmr-7-2-5
Received April 07, 2019; Revised May 11, 2019; Accepted May 28, 2019

Abstract

In Nigeria, increasing cases of food borne diseases especially diarrhea reported by many families has been linked to consumption of microbial contaminated flour based meals. Exposed and packaged cassava, yam and plantain flour are locally available in our markets. In this study, standard microbiological methods were used to isolate and identify bacterial and fungal isolates from the flour samples. Further characterization of the isolates was done using molecular methods. Our results shows that Bacillus sp. (46.67 %), Staphylococcus sp. (40 %), Escherichia coli (10 %) and Salmonella sp. (3.33 %) is the percentage frequency of occurrence of bacterial isolates; Microsporum audouinii (14.08 %), M. canis (2.82 %), M. nanum (5.63 %), Exserohilum sp. (9.86 %), Trichoderma sp. (7.04 %), Candida tropicalis (5.63 %), C. rugosa (9.9 %), C. krusei (2.82 %) C. glabrata (5.63 %), Aspergillus fumigatus (4.23 %), A. flavus (1.41 %), A. terreus (2.83 %), A. versicolor (1.41 %), A. clavatus (2.82 %), A. niger (5.63 %), Phaeoacremonim sp. (1.41 %), Epicoccum sp. (2.82 %), Exophiala dermatitidis (1.41 %), Penicillium sp. (1.41 %), Cokeromyces sp. (2.82 %), Aureobasidium sp. (1.41 %), Rhodotorula sp. (2.82 %), Fonsecaea pedrosoi (1.41 %) and Phoma sp. (2.82 %) are percentage frequency of occurrence of fungal isolates. Molecular characterization revealed the bacterial isolates to be Bacillus megaterium strain WSH10 16S, Enterobacter sp. strain HZ21, Alcaligenes feacalis strain CGAPGPBS and Acinetobacter junii strain SB132 while the fungal isolates are Aspergillus niger strain NI26, Paecilomyces sinensis strain Gr133 and Tramestes polyzona strain CNRMA14.236. It is recommended that edible flours should be produced under strict hygienic condition and packaged to prevent microbial contamination of the products.

1. Introduction

Plantain, cassava and yam are high starchy staple foods consumed by many families in Nigeria. These staples are highly perishable because of its high moisture content which supports microbial spoilage. Therefore, they are usually processed into edible flours which have reduced moisture content and longer shelf life than freshly harvested yam, plantain and cassava. Low moisture content of edible flour is unfavourable to support growth of microorganisms 1, 2, 3.

Cassava, yam and plantain as edible flours have different food applications 2, 4, 5. Apart from its nutritional importance mainly in providing energy to human body, cassava and yam could be beneficial to human health as a result of hypocholesterolemic, antioxidative, hypoglycemic, immunomodulatory and antimicrobial activities of bioactive constituents in the tubers 6. In Nigeria, some orthodox and traditional medical personnel recommend plantain flour as a diet that can help diabetic patients manage their health condition 7.

Notwithstanding low water activity of yam, cassava and plantain flour, contamination of these edible flours by pathogenic and non-pathogenic microorganisms could occur during processing 8, 9. Unhygienic handling of these edible products and undue expose to environment during retailing also predisposes edible flours to microbial contamination. In Nigerian markets, edible flours especially the ones produced by local farmers are usually exposed during retailing while others produced by cottage industries are usually packaged. Consumption of flour-based products could lead to outbreak of diseases such as diarrhea despite application of heat in the form of baking and cooking at the point where flour is used for food production 7, 10.

In most published works, microbiological quality of edible flours such as cassava, plantain and yam flour were determined using conventional methods 9, 11, 12. Recently, Odu et al. 13 carried out a study that investigated the microbiological quality of packaged and exposed cassava, yam and plantain flour sold in markets and supermarkets in Port Harcourt Nigeria. They reported the presence of coliforms, Escherichia coli, Salmonella sp., Staphylococcus sp., Bacillus sp. and fungi in the flour samples. Using conventional method, Odetunde et al. 14 isolated Flavobacterium sp., Micrococcus sp., Bacillus subtilis, B. polymyxa, B. cereus and Esherichia coli from cassava flour. In a related study, Ajayi 15 detected Escherichia coli, Klebsiella sp., Bacillus cereus, B. globisporus, B. circulans and Enterococcus spp. in dry plantain flour. Somorin et al. 12 reported that Bacillus megaterium, Staphylococcus saprophyticus, Fusarium oxysporum, Aspergillus niger and Rhizopus nigricans were present in flour obtained from water yam and white yam. However, their method of identifying microorganisms has its limitations. Molecular identification methods have proven to be more reliable and advantageous than culture-based methods in food safety microbiology 16, 17, 18. So far, there are limited studies that involved molecular methods in identification of potentially pathogenic microorganisms in cassava, plantain and yam flour placed in the markets and supermarkets for public consumption 7.

Therefore, this study is aimed at microbiological analysis and the use of molecular methods to identify bacteria and fungi present in exposed and packaged cassava, yam and plantain flour available in some open markets and supermarkets in Port Harcourt metropolis, Rivers State, Nigeria.

2. Materials and Methods

Five edible flour samples each of packaged cassava, yam and plantain flour totaling fifteen (15) samples were obtained from three supermarkets in Port Harcourt, Nigeria. Similarly, fifteen (15) plastic containers already sterilized were used to separately put five samples each of exposed cassava, plantain and yam flour purchased from fifteen retailers in three popular open markets within Port Harcourt metropolis. All the flour samples were taken to Food and Industrial Microbiology Laboratory, University of Port Harcourt where analysis were conducted.

2.1. Microbiological Analysis

Microbiological analysis of the flour samples were carried out using the methods described by Odu et al. 19 including that of Eman and Sarifar 20. Presence of Salmonella sp. in the flour samples were ascertained using APHA method 21. Identification of bacterial isolates was based on the methods described by Cheesbrough 22 while that of fungal isolates were made possible using the method described by Frazier and WestHoff 23.

2.2. Bacterial DNA Extraction

DNA extraction method as described by Chikere and Ekwuabu 24 was adopted. Five milliliter (5 ml) of an overnight broth culture of bacteria isolates in Luria bertani (LB) broth was spun using centrifuge at 1400 rpm for 3 min; the cell was suspended in 500 µl of normal saline and heated at 95°C for 20 min. The suspended bacteria already heated was fast cooled on ice and spun at 1400 rpm for 3 min. The supernatant containing DNA was transferred into 1.5 ml microcentrifuge tube and stored at -20°C. Nanodrop 1000 spectrophotometer was used to quantify the extracted genome.

2.3. Fungal DNA Extraction

Extraction of fungal DNA was done using a ZR fungal/bacterial DNA miniprep extraction kit supplied by Inqaba South Africa. Pure culture of fungal isolates which displayed heavy growth was suspended in 200 µL of isotonic buffer into a ZR bashing bead lysis tubes and 750 µL lysis solution was added to the tube. The tubes were secured in a bead beater fitted with a 2 ml tube holder assembly and processed at maximum speed for 5 mins. The ZR bashing bead lysis tubes were centrifuged at 10,000xg for 1 min. Four hundred (400) microlitres of supernatant was transferred to a Zymo-Spin IV spin filter (orange top) in a collection tube and centrifuged at 7000xg for 1 min. One thousand two hundred (1200) microlitres of fungal/bacterial DNA binding buffer was added to the filtrate in the collection tubes bringing the final volume to 1600 µL. Exactly 800 µL was then transferred to a Zymo-Spin IIC column in a collection tube and centrifuged at 10,000xg for 1 min. The flow through was discarded from the collection tube and the remaining volume was transferred to the same Zymo-spin and spun. Two hundred (200) microlitre of the DNA Pre-WAS buffer was added to the Zymo-spin IIC in a new collection tube and spun at 10,000xg for 1 min followed by the addition of 500 µL of fungal DNA Wash Buffer and centrifuged at 10,000xg for 1 min. The Zymo-spin IIC column was transferred to a clean 1.5 µL centrifuge tube, 100 µL of DNA elution buffer was added to the column matrix and centrifuged at 10,000xg for 30 sec to elute DNA. The ultra pure DNA was then stored at -20 o C for other downstream reaction.

2.4. Internal Transcribed Space (ITS) Amplification

Aided by ABI 9700 Applied Biosystems thermal cycler, ITS region of rRNA genes of the bacterial isolates were amplified using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers at a final volume of 50 µL for 35 cycles. The polymerase chain reaction (PCR) mix was made up of X2 Dream taq Master mix supplied by Inqaba, South Africa (taq polymerase, dNTPs, MgCl2), primers at a concentration of 0.4 M and extracted DNA which was the template. The PCR conditions were as follows: Initial denaturation, 95°C for 5 min; denaturation, 95°C for 30 sec; annealing, 53°C for 30 sec; extension, 72°C for 30 sec and final extension, 72°C for 5 min. The product was resolved on a 1.5 % agarose gel at 120 V for 15 min and then visualized using UV transilluminator.

2.5. 16S rRNA Amplification

The 16S rRNA region of the rRNA genes of the isolates were amplified using the 27F and 1492R primers on a ABI 9700 Applied Biosystems thermal cycler at a final volume of 50 µL for 35 cycles. The PCR mix included: the X2 Dream taq Master mix supplied by Inqaba, South Africa (taq polymerase, dNTPs, MgCl2), the primers at a concentration of 0.4 M and the extracted DNA as template. The PCR conditions were as follows: Initial denaturation, 95°C for 5 min; denaturation, 95°C for 30 sec; annealing, 52°C for 30 sec; extension, 72°C for 30 sec for 35 cycles and final extension, 72°C for 5 min. The product was resolved on a 1 % agarose gel at 120 V for 15 min and visualized on a UV transilluminator.

2.6. Sequencing

BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa was used for sequencing amplified 16S rRNA of the isolates.

2.7. Phylogenetic Analysis

The sequences obtained were edited using the Bioinformatics Algorithm Trace Edit. Similar sequences were downloaded from the National Center for Biotechnology Information (NCBI) database using BLASTN. These sequences were aligned using ClustalX. The evolutionary history was inferred using the Neighbor-Joining method in MEGA 6.0 25. The bootstrap consensus tree inferred from 500 replicates is taken to represent the evolutionary history of the taxa analyzed 26. Jukes-Cantor method was used to compute the evolutionary distances 27.

3. Results

Table 1 shows the colonial morphology and biochemical characteristics of Salmonella sp., Staphylococcus sp., Bacillus sp. and Escherichia coli isolated from packaged and exposed cassava, yam and plantain flour. Frequency of occurrence of bacterial isolates from all the flour samples presented in Figure 1 shows that Bacillus sp. (46.67 %) was predominant but Salmonella sp. (3.33 %) had the least frequency of occurrence. The characteristics of fungi isolated from exposed and packaged cassava flour is presented in Table 2 and Table 3, respectively. In Table 4 and Table 5, the characteristic of fungi isolated from exposed and packaged plantain flour, respectively is reported. Similarly, Table 6 and Table 7 describes the characteristics of fungi isolated from packaged and exposed yam flour. Frequency of occurrence of fungal isolates from packaged and exposed cassava, yam and plantain flour is stated in Figure 2. Agarose gel electrophoresis showing the amplified 16S rRNA and ITS (600bp) of the bacterial and fungal isolates is reported in Figure 3 and Figure 4, respectively. Table 8 shows the result of presumptive and molecular characterization of isolates from exposed and packaged cassava, yam and plantain flour. Phylogenetic tree showing evolutionary relationship between the fungal and bacterial isolates is reported in Figure 5 and Figure 6, respectively.

4. Discussion

A total of fourteen fungal genera were isolated from the flour samples of which Microsporum sp., Candida sp. and Aspergillus sp. were predominant. In a related study, Ajayi 15 reported that Aspergillus niger, A. fumigatus, Penicillium chrysogenum, Saccharomyces cerevisiae, Fusarium spp. Rhizopus stolonifer and Mucor spp. were present in wet and dry plantain. Studies carried out by Omohimi et al. 2 and Odetunde et al. 14 also reported that Aspergillus sp. and Penicillium sp. was predominant in retailed yam and cassava flours. The presence of fungal isolates in cassava, yam and plantain flour could have resulted from contamination during processing. A related study by Somorin et al. 12 identified Aspergillus niger, A. flavus, Penicillium oxalicum, P. citrinum from milling machines used in yam flour processing.

This study has shown that Escherichia coli were present in the edible flour samples which recorded 10 % frequency of occurrence. A related study by Ojokoh and Gabriel 28 reported that E. coli was present in yam flour which they suggested could be as a result of improper handling of the flour samples as well as washing and steeping water used during processing. According to Gacheru et al. 8, E. coli was only detected in one sample of cassava flour out of many samples that were tested. The presence of E. coli in the edible flour samples is an indication of degree of feacal contamination both from human and animals. Presence of E. coli in plantain flour was reported by Ajayi 15. Contamination of food by Escherichia coli including other food borne pathogens such as Staphylococcus aureus and Bacillus cereus poses a threat to public health 29.

Bacillus sp. was the predominant bacteria isolated from exposed and packaged cassava, plantain and yam flour. Its frequency of occurrence was 46.67 %. This result is in agreement with a similar study by Addo et al. 30. Bacillus sp. is a spore former widely distributed in nature. The spores can withstand very high temperature and has the ability to produce enterotoxins which is poisonous to humans 31. In a related study that involved microbiological quality of plantain flour, Ajayi 15 also isolated Bacillus cereus from plantain flour.

Another dominant bacterium isolated from exposed and packaged cassava, yam and plantain the flour samples was Staphylococcus sp. which recorded 40 % frequency of occurrence. In a related study, Somorin et al. 12 isolated S. aureus, S. saprophyticus, S. epidermidis from commercially milled white yam flour. The commonest specie of Staphylococcus ubiquitous in nature is S. aureus 32. Enterotoxins released by S. aureus are responsible for staphylococcal food-borne disease (SFD). Globally, SFD is considered as one of the most common food-borne diseases. This could be as a result of improper food handling practices especially in retail food industry 33, 34. Foods such as flour extensively manipulated using hand is often associated with staphylococcal food poisoning 32.

Among the four bacterial genera isolated from cassava, plantain and yam flour samples, Salmonella sp. had the lowest frequency of occurrence (3.33 %). Although the frequency of occurrence is low, its presence only in exposed plantain flour obtained from OM open market should be considered as a threat to public health 13. Although Djeri et al. 35, reported absence of Salmonella sp. in yam chips used in processing yam flour, contamination of the final product could still occur. Salmonella sp. is a causative agent of salmonellosis which is a food borne disease. Inappropriate storage of food and preparation of food in a very large quantity are some of the factors that increase the risk of food poisoning caused by Salmonella sp. 36.

The presence of Aspergillus sp. in the flour samples should be a thing of serious concern because it could produce aflatoxins. Poor storage conditions and traditional processing methods could encourage growth of Aspergillus sp. in cassava products such as cassava flour 37. Penicillium sp. infection could cause rhinocerebral mucormycosis, mucocutaneous, genitourinary, gastrointestinal, pulmonary and disseminated infections 15. Microsporum is among dematophyte species that cause Tinea capitis which is predominant disease that affect preadolescent children 38, 39, 40. Candida sp. and Alternaria sp. are among common fungi that could contaminate or cause food spoilage. For example Candida kefyr could cause bloodstream infection 41.

Molecular characterization results revealed that Bacillus sp. showed 100 % similarity to Bacillus megaterium strain WSH10 16S, Salmonella sp. showed 100 % similarity to Enterobacter sp. strain HZ21, Staphylococcus sp. showed 100 % similarity to Alcaligenes feacalis strain CGAGPBS and Staphylococcus sp. showed 100 % similarity to Acinetobacter junii strain SB132. As for the fungal isolates, Aspergillus sp. showed 98.8 % similarity to Aspergillus niger strain NI26, Candida sp. showed 99.6 % similarity to Paecilomyces sinensis strain Gr133 and Microsporum audounii showed 99.6 % similarity to Tramestes polyzona strain CNRMA14.236. The result emanating from molecular characterization of bacterial and fungal isolates was submitted to GenBank in NCBI database using assigned accession number of Bacillus megaterium (MG825417), Enterobacter sp. (MG825418), Alcaligenes feacalis (MG825419), Acinetobacter junii (MG825423), Aspergillus niger (MG825420), Paecilomyces sinensis (MG825421) and Tramestes polyzona (MG825422). Aruwa and Ogundare 9, reported the presence of Acinetobacter sp. Enterobacter sp. in cassava flour (pupuru)

5. Conclusion

Bacillus sp., Escherichia coli, Salmonella sp. and Staphylococcus sp. were identified as bacterial isolates while Microsporum sp., Exserohilum sp., Trichoderma sp., Candida sp., Aspergillus sp., Phaeoacremonim sp., Epicoccum sp., Exophiala sp., Penicillium sp., Cokeromyces sp., Aureobasidium sp., Rhodotorula sp., Fonsecaea sp. and Phoma sp. were fungal isolates identified in the flour samples using standard microbiological methods. Further characterization of the isolates using molecular methods revealed the bacterial isolates to be Bacillus megaterium strain WSH10 16S, Enterobacter sp. strain HZ21, Alcaligenes feacalis strain CGAPGPBS and Acinetobacter junii strain SB132 while that of fungal isolates are Aspergillus niger strain NI26, Paecilomyces sinensis strain Gr133 and Tramestes polyzona strain CNRMA14.236. In addition to using conventional microbiological methods to identify bacteria and fungi present in packaged and exposed cassava, yam and plantain flour sampled from selected supermarkets and open markets in Port Harcourt, Rivers State, Nigeria, this study has also provided useful information by identifying the strains involved using molecular methods.

Competing Interests

Authors have declared that no competing interests exist.

Funding Statement

This study was funded by the authors.

References

[1]  Omowunmi OO, Motunrayo EL. Effect of different sun drying surfaces on the functional properties and microbial loads of unripe plantain flours. Frontiers Environ. Microbiol. 2017; 3 (3): 50-55.
In article      View Article 
 
[2]  Omohimi C, Piccirillo C, Ferraro V, Roriz MC, Omemu MA, Santos SM, Ressurreição SD, Abayomi L, Adebowale A, Vasconcelos MW, Obadina O, Sanni L, Pintado MME. Safety of yam-derived (Dioscorea rotundata) foodstuffs-chips, flakes and post-processing conditions. Foods. 2019; 8 (12):1-19.
In article      View Article  PubMed  PubMed 
 
[3]  Onyenwoke CA, Simonyan KJ. Cassava post-harvest processing and storage in Nigeria: A review. African. J Agric. Resear. 2014; 9 (53): 3853-3863.
In article      
 
[4]  Ogundare-Akanmu OA, Inana ME, Adindu MN. Preliminary quality evaluation of selected plantain flour (Musa paradisiacal) sold in Port Harcourt markets, Nigeria. Food Sci. Quality Mgt. 2015; 35: 7-10.
In article      
 
[5]  Fakir MSA, Jannat M, Mostafa MG, Seal H. Starch and flour extraction and nutrient composition of tuber in seven cassava accessions. J. Bangladesh Agric. Univ. 2012, 10 (2): 217-222.
In article      View Article 
 
[6]  Chandrasekara A, Kumar TJ. Roots and tuber crops as functional foods: A review on phytochemical constituents and their potential health benefits. Intl. J Food Sci. 2016; 1-15.
In article      View Article  PubMed  PubMed 
 
[7]  Kenechukwu AO, Ndidi OCL. Public health significance of food borne pathogens in edible flours. Afri. J Microbiol. Resear. 2015; 9 (8): 509-514.
In article      View Article 
 
[8]  Gacheru PK, Abong GO, Okth MW, Lamuka SA, Shibairo SA, Katama CKM. Microbiological safety and quality of dried cassava chips and flour sold in the Nairobi and coastal regions of Kenya. Afri. Crop Sci. J 2016; 24: 137-143.
In article      View Article 
 
[9]  Aruwa CE, Ogundare O. Microbiological quality assessment of pupuru and plantain flours in an Urban market in Akure, Ondo State, South Western Nigeria. Open Access Library J. 2017; 4: 1-11.
In article      View Article 
 
[10]  Alum EA, Urom SMOC, Ben CMA. Microbiological contamination of food: The mechanisms, impacts and prevention. Intl. J Sci. Technol. Resear. 2016; 5 (3): 65-78.
In article      
 
[11]  Eleazu CO, Amajor JU, Ikpeama AI, Awa E. Studies on the nutrient composition, antioxidant activities, functional properties and microbial load of the flours of 10 elite cassava (Manihot esculenta) varieties. Asian J Clin. Nutri. 2011; 3 (1): 33-39.
In article      View Article 
 
[12]  Somorin YM, Bankole MO, Omemu AM, Atanda OO. Impact of milling on the microbiological quality of yam flour in Southwestern Nigeria. Resear. J Microbiol. 2011; 6: 480-487.
In article      View Article 
 
[13]  Odu NN, Elenwo M, Maduka N. Microbiological quality of packaged and exposed cassava, yam and plantain flour sold in markets and supermarkets in Port Harcourt metroplolis, Nigeria. American J Microbiol. Resear. 2019; 7 (2): 57-62.
In article      
 
[14]  Odetunde SK, Adebajo LO, Lawal AK, Itoandon EE. Investigation of microbiological and chemical characteristics of cassava flour in Nigeria. Global Adv. Resear. J Microbiol. 2014; 3 (3): 031-040.
In article      
 
[15]  Ajayi AO. Microbiological quality of plantain (Musa paradisiacal). Nig. J Microbiol. 2016; 30(2): 3962-3969.
In article      
 
[16]  Ceuppens S, Li D, Uyttendaele M, Renault P, Ross P, Ranst MV, Cocolin L, Donaghy J. Molecular methods in food safety microbiology: Interpretation and implications of nucleic acid detection. Comprehensive Reviews Food Sci. Food Safety. 2014; 13: 551-577.
In article      View Article 
 
[17]  Field KG, Bernhard AE, Brodeur TJ. Molecular approaches to microbiological monitoring: faecal source detection. Environmental Monitoring Assessment. 2003, 81: 313-326.
In article      View Article  PubMed 
 
[18]  de Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. PCR detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of Gladiolus yellows disease, from infected corms. Plant Pathology. 2000; 49: 89-100.
In article      View Article 
 
[19]  Odu NN, Njoku HO, Mepha HD. Microbiological quality of smoked-dried mangrove oysters (Crassoostrea gasar) sold in Port Harcourt, Nigeria. Agric. Bio. J North America. 2012; 3(9): 360-364.
In article      View Article 
 
[20]  Eman MS, Sherifa MS. Microbiological loads for some types of cooked chicken meat products at Al-Taif Governorate, KSA. World Applied Sci. J. 2012; 17 (5): 593-597.
In article      
 
[21]  APHA (American Public Health Association), (2001). In F. P. Downes and K. Ito (Eds.). Compendium of methods for the microbiological examination of foods (4th edition). Washington, DC: American Public Health Association.
In article      
 
[22]  Cheesbrough M. District Laboratory Practice in Tropical Countries, Part 2. Cambridge University Press, 2000, 400- 434.
In article      
 
[23]  Frazier WC, WestHoff DC. Classification and isolation of moulds /yeast and yeast like fungi in food microbiology 4th edition. McGraw-Hill Book Company Singapore. 2000; 243-253.
In article      
 
[24]  Chikere CB, Ekwuabu CB. Molecular characterization of autochthonous hydrocarbon utilizing bacteria in oil-polluted sites at Bodo Community, Ogoni land, Niger Delta, Nigeria. Nig. J Biotech. 2014; 27: 28-33.
In article      
 
[25]  Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Bio. Evolution. 1987; 4: 406-425.
In article      
 
[26]  Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985; 39:783-791.
In article      View Article  PubMed 
 
[27]  Jukes TH, Cantor CR. Evolution of protein molecules In: Mammalian Protein Metabolism. Munro HN (editor) Academic Press, New York. 1969; p. 21-132.
In article      View Article 
 
[28]  Ojokoh AO, Gabriel RAO. A comparative study on the storage of yam chips (gbodo) and yam flour (elubo). Afri. J Biotech. 2010; 9 (21): 3175-3177.
In article      
 
[29]  Lateef A, Ojo MO. Public health issues in the processing of cassava (Manihot esculenta) for the production of lafun and the application of hazard analysis control measures. Quality Assurance Safety Crops Foods. 2016; 8 (10): 165-177.
In article      View Article 
 
[30]  Addo MG, Akanwanwiak WG, Addo-Fordjour P, Obiri-Danso K. Microbiological and sensory analysis of imported fruit juices in Kumasi Ghana. Resear. J Microbiol. 2008, 3: 552-558.
In article      View Article 
 
[31]  Adeleke SI. Food poisoning due to yam (Dioscorea rotundata) consumption in Kano (Northwest) Nigeria. J Health Allied Sci. 2009; 8: 10-12.
In article      
 
[32]  Shimamura Y, Kidokoro S, Murata M. Survey and properties of Staphylococcus aureus isolated from Japanese-style desserts. Biosci. Biotech. Biochem. 2006; 70 (7): 1571-1577.
In article      View Article  PubMed 
 
[33]  Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and Staphylococcal food-borne disease: An ongoing challenge in public health. Biomed Resear. Intl. 2014; 1-9.
In article      View Article  PubMed  PubMed 
 
[34]  Hennekinne JA, Buyser ML, Dragacci S. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Reviews. 2011; 36: 815-836.
In article      View Article  PubMed 
 
[35]  Djeri B, Ameyapoh Y, Karou DS, Anani K., Soney K, Adjrah Y, Souz C. Assessment of microbiological qualities of yam chips marketed in Togo. Adv. J Food Sci. Tech. 2010; 2 (5): 236-241.
In article      
 
[36]  Rahman HS, Othhman HH. Salmonella infection: The common cause of human food poisoning. Progress Biosci. Bioengineering. 2017; 1 (1): 5-10.
In article      View Article 
 
[37]  Kaaya AN, Eboku D. Mould and aflatoxin contamination of dried cassava chips in Eastern Uganda: association with traditional processing and storage practices. J Bio. Sci. 2010; 10 (8): 718-729.
In article      View Article 
 
[38]  Ngwogu AC, Otokunefor TV. Epidemiology of dermatophytoses in rural community in Eastern Nigeria and review of literature from Africa. Mycopathologia. 2007; 164: 149-158.
In article      View Article  PubMed 
 
[39]  Silverberg NB, Weinberg JM, De Leo VA. Tinea capitis: Focus on African American women. J American Acad. Dermatology. 2002; 46: 120-124.
In article      View Article 
 
[40]  Abdel-Rahman SM, Herron J, Fallon-Friedlander S, Hauffe S, Horowitz A, Riviere GJ. Pharmacokinetics of terbinafine in young children treated for Tinea capitis. Pediatric Infectious Disease J. 2005; 24 (10): 886-891.
In article      View Article 
 
[41]  Benedict K, Chiller TM, Mody RK. Invasive fungal infections acquired from contaminated food or nutritional supplements: A review of the literature. Foodborne Pathogenic Diseases. 2016; 13 (7): 343-349.
In article      View Article  PubMed  PubMed 
 

Published with license by Science and Education Publishing, Copyright © 2019 Ngozi Nma Odu and Ndukwe Maduka

Creative CommonsThis work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Cite this article:

Normal Style
Ngozi Nma Odu, Ndukwe Maduka. Microbiological Analysis and Molecular Characterization of Bacterial and Fungal Isolates Present in Exposed and Packaged Cassava, Plantain and Yam Flour Sold in Selected Markets in Port Harcourt, Rivers State, Nigeria. American Journal of Microbiological Research. Vol. 7, No. 2, 2019, pp 63-72. http://pubs.sciepub.com/ajmr/7/2/5
MLA Style
Odu, Ngozi Nma, and Ndukwe Maduka. "Microbiological Analysis and Molecular Characterization of Bacterial and Fungal Isolates Present in Exposed and Packaged Cassava, Plantain and Yam Flour Sold in Selected Markets in Port Harcourt, Rivers State, Nigeria." American Journal of Microbiological Research 7.2 (2019): 63-72.
APA Style
Odu, N. N. , & Maduka, N. (2019). Microbiological Analysis and Molecular Characterization of Bacterial and Fungal Isolates Present in Exposed and Packaged Cassava, Plantain and Yam Flour Sold in Selected Markets in Port Harcourt, Rivers State, Nigeria. American Journal of Microbiological Research, 7(2), 63-72.
Chicago Style
Odu, Ngozi Nma, and Ndukwe Maduka. "Microbiological Analysis and Molecular Characterization of Bacterial and Fungal Isolates Present in Exposed and Packaged Cassava, Plantain and Yam Flour Sold in Selected Markets in Port Harcourt, Rivers State, Nigeria." American Journal of Microbiological Research 7, no. 2 (2019): 63-72.
Share
  • Figure 3. Agarose gel electrophoresis showing amplified 16S rRNA of the bacterial isolates. Lane L represents the 100bp molecular ladder. The lanes (1, 2, 3, 4) express the level of migration of genes on the agarose gel
  • Figure 4. Agarose gel electrophoresis showing amplified ITS (600bp) of the fungal isolates. The lanes (1,2,3,4) express the level of migration of genes on the agarose gel
  • Table 1. Colonial morphology and biochemical characteristics of bacterial isolate from packaged and exposed edible flour
[1]  Omowunmi OO, Motunrayo EL. Effect of different sun drying surfaces on the functional properties and microbial loads of unripe plantain flours. Frontiers Environ. Microbiol. 2017; 3 (3): 50-55.
In article      View Article 
 
[2]  Omohimi C, Piccirillo C, Ferraro V, Roriz MC, Omemu MA, Santos SM, Ressurreição SD, Abayomi L, Adebowale A, Vasconcelos MW, Obadina O, Sanni L, Pintado MME. Safety of yam-derived (Dioscorea rotundata) foodstuffs-chips, flakes and post-processing conditions. Foods. 2019; 8 (12):1-19.
In article      View Article  PubMed  PubMed 
 
[3]  Onyenwoke CA, Simonyan KJ. Cassava post-harvest processing and storage in Nigeria: A review. African. J Agric. Resear. 2014; 9 (53): 3853-3863.
In article      
 
[4]  Ogundare-Akanmu OA, Inana ME, Adindu MN. Preliminary quality evaluation of selected plantain flour (Musa paradisiacal) sold in Port Harcourt markets, Nigeria. Food Sci. Quality Mgt. 2015; 35: 7-10.
In article      
 
[5]  Fakir MSA, Jannat M, Mostafa MG, Seal H. Starch and flour extraction and nutrient composition of tuber in seven cassava accessions. J. Bangladesh Agric. Univ. 2012, 10 (2): 217-222.
In article      View Article 
 
[6]  Chandrasekara A, Kumar TJ. Roots and tuber crops as functional foods: A review on phytochemical constituents and their potential health benefits. Intl. J Food Sci. 2016; 1-15.
In article      View Article  PubMed  PubMed 
 
[7]  Kenechukwu AO, Ndidi OCL. Public health significance of food borne pathogens in edible flours. Afri. J Microbiol. Resear. 2015; 9 (8): 509-514.
In article      View Article 
 
[8]  Gacheru PK, Abong GO, Okth MW, Lamuka SA, Shibairo SA, Katama CKM. Microbiological safety and quality of dried cassava chips and flour sold in the Nairobi and coastal regions of Kenya. Afri. Crop Sci. J 2016; 24: 137-143.
In article      View Article 
 
[9]  Aruwa CE, Ogundare O. Microbiological quality assessment of pupuru and plantain flours in an Urban market in Akure, Ondo State, South Western Nigeria. Open Access Library J. 2017; 4: 1-11.
In article      View Article 
 
[10]  Alum EA, Urom SMOC, Ben CMA. Microbiological contamination of food: The mechanisms, impacts and prevention. Intl. J Sci. Technol. Resear. 2016; 5 (3): 65-78.
In article      
 
[11]  Eleazu CO, Amajor JU, Ikpeama AI, Awa E. Studies on the nutrient composition, antioxidant activities, functional properties and microbial load of the flours of 10 elite cassava (Manihot esculenta) varieties. Asian J Clin. Nutri. 2011; 3 (1): 33-39.
In article      View Article 
 
[12]  Somorin YM, Bankole MO, Omemu AM, Atanda OO. Impact of milling on the microbiological quality of yam flour in Southwestern Nigeria. Resear. J Microbiol. 2011; 6: 480-487.
In article      View Article 
 
[13]  Odu NN, Elenwo M, Maduka N. Microbiological quality of packaged and exposed cassava, yam and plantain flour sold in markets and supermarkets in Port Harcourt metroplolis, Nigeria. American J Microbiol. Resear. 2019; 7 (2): 57-62.
In article      
 
[14]  Odetunde SK, Adebajo LO, Lawal AK, Itoandon EE. Investigation of microbiological and chemical characteristics of cassava flour in Nigeria. Global Adv. Resear. J Microbiol. 2014; 3 (3): 031-040.
In article      
 
[15]  Ajayi AO. Microbiological quality of plantain (Musa paradisiacal). Nig. J Microbiol. 2016; 30(2): 3962-3969.
In article      
 
[16]  Ceuppens S, Li D, Uyttendaele M, Renault P, Ross P, Ranst MV, Cocolin L, Donaghy J. Molecular methods in food safety microbiology: Interpretation and implications of nucleic acid detection. Comprehensive Reviews Food Sci. Food Safety. 2014; 13: 551-577.
In article      View Article 
 
[17]  Field KG, Bernhard AE, Brodeur TJ. Molecular approaches to microbiological monitoring: faecal source detection. Environmental Monitoring Assessment. 2003, 81: 313-326.
In article      View Article  PubMed 
 
[18]  de Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. PCR detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of Gladiolus yellows disease, from infected corms. Plant Pathology. 2000; 49: 89-100.
In article      View Article 
 
[19]  Odu NN, Njoku HO, Mepha HD. Microbiological quality of smoked-dried mangrove oysters (Crassoostrea gasar) sold in Port Harcourt, Nigeria. Agric. Bio. J North America. 2012; 3(9): 360-364.
In article      View Article 
 
[20]  Eman MS, Sherifa MS. Microbiological loads for some types of cooked chicken meat products at Al-Taif Governorate, KSA. World Applied Sci. J. 2012; 17 (5): 593-597.
In article      
 
[21]  APHA (American Public Health Association), (2001). In F. P. Downes and K. Ito (Eds.). Compendium of methods for the microbiological examination of foods (4th edition). Washington, DC: American Public Health Association.
In article      
 
[22]  Cheesbrough M. District Laboratory Practice in Tropical Countries, Part 2. Cambridge University Press, 2000, 400- 434.
In article      
 
[23]  Frazier WC, WestHoff DC. Classification and isolation of moulds /yeast and yeast like fungi in food microbiology 4th edition. McGraw-Hill Book Company Singapore. 2000; 243-253.
In article      
 
[24]  Chikere CB, Ekwuabu CB. Molecular characterization of autochthonous hydrocarbon utilizing bacteria in oil-polluted sites at Bodo Community, Ogoni land, Niger Delta, Nigeria. Nig. J Biotech. 2014; 27: 28-33.
In article      
 
[25]  Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Bio. Evolution. 1987; 4: 406-425.
In article      
 
[26]  Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985; 39:783-791.
In article      View Article  PubMed 
 
[27]  Jukes TH, Cantor CR. Evolution of protein molecules In: Mammalian Protein Metabolism. Munro HN (editor) Academic Press, New York. 1969; p. 21-132.
In article      View Article 
 
[28]  Ojokoh AO, Gabriel RAO. A comparative study on the storage of yam chips (gbodo) and yam flour (elubo). Afri. J Biotech. 2010; 9 (21): 3175-3177.
In article      
 
[29]  Lateef A, Ojo MO. Public health issues in the processing of cassava (Manihot esculenta) for the production of lafun and the application of hazard analysis control measures. Quality Assurance Safety Crops Foods. 2016; 8 (10): 165-177.
In article      View Article 
 
[30]  Addo MG, Akanwanwiak WG, Addo-Fordjour P, Obiri-Danso K. Microbiological and sensory analysis of imported fruit juices in Kumasi Ghana. Resear. J Microbiol. 2008, 3: 552-558.
In article      View Article 
 
[31]  Adeleke SI. Food poisoning due to yam (Dioscorea rotundata) consumption in Kano (Northwest) Nigeria. J Health Allied Sci. 2009; 8: 10-12.
In article      
 
[32]  Shimamura Y, Kidokoro S, Murata M. Survey and properties of Staphylococcus aureus isolated from Japanese-style desserts. Biosci. Biotech. Biochem. 2006; 70 (7): 1571-1577.
In article      View Article  PubMed 
 
[33]  Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and Staphylococcal food-borne disease: An ongoing challenge in public health. Biomed Resear. Intl. 2014; 1-9.
In article      View Article  PubMed  PubMed 
 
[34]  Hennekinne JA, Buyser ML, Dragacci S. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Reviews. 2011; 36: 815-836.
In article      View Article  PubMed 
 
[35]  Djeri B, Ameyapoh Y, Karou DS, Anani K., Soney K, Adjrah Y, Souz C. Assessment of microbiological qualities of yam chips marketed in Togo. Adv. J Food Sci. Tech. 2010; 2 (5): 236-241.
In article      
 
[36]  Rahman HS, Othhman HH. Salmonella infection: The common cause of human food poisoning. Progress Biosci. Bioengineering. 2017; 1 (1): 5-10.
In article      View Article 
 
[37]  Kaaya AN, Eboku D. Mould and aflatoxin contamination of dried cassava chips in Eastern Uganda: association with traditional processing and storage practices. J Bio. Sci. 2010; 10 (8): 718-729.
In article      View Article 
 
[38]  Ngwogu AC, Otokunefor TV. Epidemiology of dermatophytoses in rural community in Eastern Nigeria and review of literature from Africa. Mycopathologia. 2007; 164: 149-158.
In article      View Article  PubMed 
 
[39]  Silverberg NB, Weinberg JM, De Leo VA. Tinea capitis: Focus on African American women. J American Acad. Dermatology. 2002; 46: 120-124.
In article      View Article 
 
[40]  Abdel-Rahman SM, Herron J, Fallon-Friedlander S, Hauffe S, Horowitz A, Riviere GJ. Pharmacokinetics of terbinafine in young children treated for Tinea capitis. Pediatric Infectious Disease J. 2005; 24 (10): 886-891.
In article      View Article 
 
[41]  Benedict K, Chiller TM, Mody RK. Invasive fungal infections acquired from contaminated food or nutritional supplements: A review of the literature. Foodborne Pathogenic Diseases. 2016; 13 (7): 343-349.
In article      View Article  PubMed  PubMed