Phosphorus in the phytate form is undigestible by non-ruminant animals, causing environmental problems. The transgenic potato line 2-1 was generated with high phytase expression, and it could be a potential feed to improve phytate-P digestibility in non-ruminant animals. Compositional characteristics of genetically modified crops are one of key steps in safety assessment. To evaluate the feed safety of the transgenic potato line 2-1, the comparative analysis of compositions between the transgenic line 2-1 and the conventional line CK potato tubers for two consequent years was conducted. Only proline and zinc contents were shown to be significantly lower in both years, but within the database range. Trypsin inhibitors, lectins, and glycoalkaloids, including α-chaconines, and α-solanines, were also analyzed, and the contents had no significant differences between the two potato lines. The results suggested that the composition of the transgenic potato line 2-1 is substantially equivalent to that of the conventional line CK.
Phytate (myo-inositol hexaphosphate) is a major storage form of phosphorus in plants and many crops which are feeds for livestock and poultry. It can be hydrolyzed to phosphorus and other nutrients to generate energy for plant growth by phytase. Since phytase is not present in the gastrointestinal tract of non-ruminants such as pigs and chickens, phytate in the feed cannot be properly utilized. Excess phytate is excreted in the feces and hydrolyzed by the soil microorganisms into phosphorus, resulting in excess phosphorus in the soil. Therefore, phytase is added to the feed to hydrolyze phytate into inorganic phosphate and myo-inositol to aid absorption by non-ruminants 1.
Potato (Solanum tuberosum L.) is the most important food crop after wheat and rice, and it is not only used as a daily meal but also as an animal feed. As well as providing starch, potatoes are rich in nutrients, such as potassium, vitamin C, vitamin B6 and fiber 2. The potato tubers can accumulate a large number of proteins due to the specialized storage organ. Potato tubers are ideal for the production of recombinant proteins.
The appA gene from Escherichia coli encoding phytase was transformed into the potato, and the transgenic potatoes increased inorganic phosphate acquisition and yield 3. The sporamin promoter confers high-level phytase expression in the tubers of the transgenic potato line 2-1. It can also enhance the absorbance of nutrients in feeds for livestock and poultry and prevent the soil from pollution. The transgenic potato line 2-1 offers an ideal feed additive for improving phytate-P digestibility in monogastric animals. Moreover, the transgenic potato with highly expressed phytase increased the tuber size, number, and yield, and the pigs fed with the transgenic potato increased serum phosphorus and bone strength in the animal feeding tests 3.
According to the World Health Organization (WHO), the Food and Agriculture Organization (FAO) and the Organization for Economic Co-operation and Development (OECD) on the safety assessment of genetically modified foods, the policies should be constructed on molecular, biological and chemical properties of food. Safety assessment of genetically modified food and feed is based on the principle of substantial equivalence, comparing genetically modified food and feed with a similar traditional food and feed that has been proven to be safe during normal use 4. A compositional analysis is important for evaluating the intended effect. The key components (such as key nutrients, anti-nutrients, and toxicants) of the genetically modified potato should be analyzed and compared to the conventional potato. Potato anti-nutrients and toxicants are those that may affect human or animal health after ingestion, including glycoalkaloids, protease inhibitors, and lectins 5.
Genetically modified food or feed have undergone various safety assessments before sell. The transgenic potato line 2-1 should be evaluated for its safety in animal use before as a feed product. In this study, we collected the transgenic potato line 2-1 and the conventional potato line CK for two consecutive years (2010 and 2011). The transgenic potato line 2-1 was compared with the conventional line CK on the contents of proximate, carbohydrate, amino acids, minerals, vitamins, anti-nutrients, and toxicants to evaluate whether they are substantially equivalent in composition.
The transgenic potato line 2-1 was constructed by Dr. Su-May Yu in the Academia Sinica 3. The transgenic potato line 2-1 and the conventional line CK were planted in isolated trial fields at the Taiwan Agriculture Research Institute in Wufeng, Taichung, Taiwan, and the potato tubers were collected for two years in 2010 and 2011.
2.2. DNA Isolation and PCR AssayPotato tubers were homogenized directly in a blender. Potato tuber powders were collected for DNA isolation by using the DNeasy® plant mini kit (Qiagen, Valencia, CA), following the manufacturer's instructions. To confirm the identities of the transgenic potato line 2-1 and the conventional potato line CK, two sets of PCR primers were designed. One set of the primers was patatin 5’ (5’ - TGACCTGGACACCACAGTTAT - 3’) and patatin 3’ (5’ - GTGGATTTCAGGAGTTCTTCGA - 3’) which were used to amplify the gene encoding patatin (a storage protein found in potato) as an internal control. The PCR product of patatin was 216 bp in size. The other set of primers was PLF1 (5’ - AGCTATATGTGTCGTCCTG T - 3’) and PIL3 (5’ - TGTGTGAGTAGTTCCCAGAT - 3’) which were specific for the transgenic potato line 2-1. The PCR product of the transgenic potato line 2-1 event specific DNA was 1,289 bp in size.
2.3. Phytase Activity AssayProtein extracts were prepared from tubers of the GM potato line 2-1. The phytase activity was determined as described 6. Briefly, 50 L of extracted proteins were incubated with 200 L of 1.5 mM sodium phytate at 37°C for 15 min. The reaction was stopped by adding 250 L of 5% trichloroacetic acid (TCA). Following production of phosphomolybdate with 0.5 ml of coloring reagent, the liberated inorganic orthophosphate (Pi) was photometrically measured at 700 nm. The coloring reagent was prepared freshly by mixing four volumes of 1.5% ammonium molybdate solution in 5.5% sulfuric acid and one volume of 2.7% ferrous sulfate solution. One unit of phytase activity was defined as the amount of enzyme that frees 1 mole inorganic Pi from 1.5 mM sodium phytate/min at pH 4.5 and 37°C. Protein concentration of total soluble proteins was determined by the Micro BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL).
2.4. Analysis of Key NutrientsProximate analysis was as previously described 7 using the standard Association of Official Analytical Chemists (AOAC) procedures. Moisture content was determined by loss of weight upon drying in an oven at 135°C for 1-3 hr, according to AOAC method 930.15 (AOAC 2012). Ash content was determined by incineration (550-600°C) of known weights of the samples in a muffle furnace, according to AOAC method 930.05 8. Crude fat content was determined by acid hydrolysis of known weights of the samples, according to AOAC method 922.06 8. Crude protein content was determined by digestion of the samples in a block digester and determination of ammonia, according to AOAC method 976.06 8. Crude fiber analysis was carried out by enzymatic gravimetry, according to AOAC method 985.29 8. Carbohydrate content was calculated as (100 [g/100 g] - moisture [g/100 g] - ash [g/100 g] - crude fat [g/100 g] - crude protein [g/100 g] - fiber [g/100 g]). Dietary fiber contents were estimated according to AOAC method 985.29 8.
Starch content was investigated by acid hydrolysis, according to AOAC method 920.44 8. Glucose, fructose, sucrose, lactose, and maltose analysis was performed by HPLC, according to Chinese National Standard (CNS) 12634-N6223 9.
For amino acid analyses, samples were hydrolyzed according to the methane disulfonic acid method and determined using HPLC 10.
Potassium, sodium, zinc, and iron were analyzed by atomic absorption spectrometry, according to AOAC method 985.35 8. Calcium, magnesium, and phosphorus were analyzed by inductively coupled plasma-optical emission spectrometry, according to AOAC method 984.27 8.
Vitamin B1 was analyzed by oxidizing thiamine to thiochrome and measuring fluorescence, according to AOAC method 986.27. Vitamin B2 was analyzed using fluorescence detection, according to AOAC method 981.15 8. Vitamin B3 (niacin) was analyzed using colorimeter detection, according to AOAC method 981.16 8. Vitamin B6 was analyzed using high pressure LC. Vitamin B6 compound was measured including pyridoxamine, pyridoxal, pyridoxine and their phosphoric acid esters 11. Folic acid content was determined by fluorometry, according to AOAC method 944.12 8. Vitamin C was analyzed using fluorescence detection, according to AOAC method 984.26. Vitamin E was analyzed using LC, according to AOAC method 2012.09 8.
2.5. Analysis for Anti-nutrientsThe content of trypsin inhibitor was determined by colorimetry, according to the American Oil Chemists’ Society (AOCS) official method Ba12-75.
The content of lectin was determined by ELISA. The anti-Solanum tuberosum lectin-antibody wasused. The absorbance at a wavelength of 410 nm was determinated.
2.6. Analysis for ToxicantsThe glycoalkaloid contents were analyzed according to AOAC official method 997.13 8. The major components of the glycoalkaloid are α-solanine (solanidine-glucose-rhamnose-rhamnose) and α-chaconine (solanidine-galactose-glucose-rhamnose). The glycoalkaloid was extracted from the potato tubers with acetic acid, followed by concentration and cleaning up on solid phase extraction columns (J. T. Baker, Phillipsburg, USA). The reference standards were α-solanine and α-chaconine (ABCR, Karlsruhe, USA). The content of total glycoalkaloid was determined by using LC with an UV detector at 202 nm 12.
2.7. Statistical AnalysisExperimental values were mean ± standard deviation (SD) from three separate experiments. Significance was assessed using student t-tests. The statistical level of significance was present at 0.05.
The transgenic potato line 2-1 and the conventional potato line CK (cultivar cv. Kennebec) were harvested in three independent regions for two consecutive years, 2010 and 2011. To confirm potato line identity, PCR was performed by using two sets of primers generating a band size of 1,289 bp for line 2-1 specific primers and 216 bp for patatin primers (Figure 1A). There were 35 transgenic potatoes line 2-1 and 29 conventional potatoes line CK samples in 2010, and 30 transgenic potatoes line 2-1 and 29 conventional potatoes line CK samples in 2011. Phytase activity of the transgenic potato tuber samples was 25.0 ± 6.0 U/mg (Figure 1B).
3.2. Key Nutrients Contents of Potato TubersThe contents of the key nutrients, anti-nutrients, and toxicants of potato samples were analyzed following the OECD guideline 5. The contents of the moisture, ash, crude fat, crude protein, crude fiber, dietary fiber and carbohydrate of the transgenic line 2-1 and conventional line CK potato tubers were analyzed and compared (Table 1). No significant difference was found in the contents of key nutrients between potato tubers line 2-1 and CK for two years, with a 5% confidence level. The moisture of the potato tubers was lower in 2011 (77.32-79.23 g/100 g) compared to that of the potato tubers in 2010 (79.26-83.29 g/100 g). The database range for potato tuber in moisture content is 71.8-85.96 g/100 g, depending on storage conditions 13. However, the moisture contents had no significant difference between the two potato tubers during the same year.
The sugar content of potato tubers varies highly depending on the variety, maturity and physiological stage of the potatoes 5. The contents of fructose, sucrose, glucose, and starch of the transgenic line 2-1 and conventional line CK potato tubers were analyzed and compared (Table 1). No significant difference was found in the contents of sugar between potato tubers line 2-1 and CK for two years, with a confidence level of 5%.
3.3. Amino Acids Contents of Potato TubersThe amino acid profile of the potato tubers was investigated in this study. Seventeen amino acids of the transgenic and the conventional potato lines were analyzed (Table 2). For potato tubers harvested in 2010, 2 of the 17 amino acid contents showed significant difference, including cysteine and proline. For potato tubers harvested in 2011, 11 of 17 amino acids showed significant difference, including threonine, serine, glycine, cysteine, isoleucine, leucine, tyrosine, phenylalanine, lysine, histidine, and proline. However, only the cysteine and proline contents showed significant difference in both years. The cysteine content of the transgenic potatoes line 2-1 was higher in 2010 but lower in 2011 compared to that of the conventional potatoes line CK. The proline contents for the two consecutive years were both significantly lower in the transgenic line 2-1 tubers (75.9 ± 3.1 mg/100 g, 61.1 ± 1.0 mg/100 g in 2010 and 2011, respectively) compared to that of the conventional line CK (85.8 ± 3.1 mg/100 g, 78.6 ± 6.1 mg/100 g in 2010 and 2011, respectively), but all within the database range of 35.46-1,450 mg/100 g 13.
3.4. Mineral and Vitamin Contents of Potato TubersSeven minerals of the transgenic line 2-1 and the conventional line CK potato tubers were analyzed, including sodium, potassium, calcium, magnesium, iron, zinc, and phosphorus (Table 3). The calcium content was significantly lower in the transgenic line 2-1 tubers harvested in 2010 (4.81 ± 0.30 mg/100 g) compared to that of the conventional line CK tubers (6.47 ± 0.59 mg/100 g), but the calcium content of the potato tubers harvested in 2011 had no significant difference. The zinc content was significantly lower in the transgenic line 2-1 tubers harvested in 2010 (0.51 ± 0.03 mg/100 g) compared to that of the conventional line CK tubers (0.60 ± 0.05 mg/100 g), and it was also significantly lower in the transgenic line 2-1 tubers harvested in 2011 (0.41 ± 0.02 mg/100 g) compared to that of the conventional line CK tubers (0.48 ± 0.02 mg/100 g). In view of the global database, the zinc content of potato tubers is 0.3 mg/100 g in Fineli food composition database 14, 0.18-0.49 mg/100 g in Frida food database 15, 0.29 mg/100 g in FoodData Central database 16, and 0.3-1.1 mg/100 g in Taiwan food nutrient database 17. The zinc content showed significant difference between the two potato lines, but was still within the database range.
Ten vitamins of the transgenic line 2-1 and the conventional line CK potato tubers were analyzed, including vitamin B1, B2, B3, B6, C, E, pyridoxamine, pyridoxal, pyridoxine, and folic acid (Table 4). Among the potato tubers harvested in 2010, only the vitamin C content was significantly lower in the transgenic line 2-1 tubers (7.02 ± 0.65 mg/100 g) compared to that of the conventional line CK tubers (10.13 ± 0.05 mg/100 g). Among the potato tubers harvested in 2011, 4 of 10 vitamin contents were significant different, including vitamin B1, B6, E, and pyridoxal. The difference of the vitamin contents was noted during single years, but not consistently throughout the two years. Furthermore, the changes in vitamin C, B1, B6, E, and pyridoxal were still within the database range 13.
Potato tubers contain trypsin inhibitors, thus decreasing the digestibility and the biological value of the ingested protein. Lectins found in potato are known to cause serious health effects when ingested by humans and animals. Potato can synthesize steroidal glycoalkaloids, such as α-chaconine and α-solanine, as a defense against parasites or when an injury occurs. The level of glycoalkaloids in 100 g fresh weight is considered safe for humans. To investigate the anti-nutrients and toxicants in the transgenic potato tubers, we examined the content of trypsin inhibitors, lectins, and α-chaconines and α-solanines (Table 5 and Figure 2). No significant difference was found in the contents of anti-nutrients and toxicants between potato tubers line 2-1 and CK for two years, with a 5% confidence level. The contents of α-chaconine and α-solanine were all within the ILSI database ranges of 10.87-462.76 mg/100 g and 9.812-246.430 mg/100 g, respectively 13.
Composition analysis for genetically modified crops is conducted to identify potential nutritional or safety issues. We analyzed and compared the compositions of the transgenic potato line 2-1 and the conventional potato line CK for two consecutive years, 2010 and 2011. We analyzed key nutrients, anti-nutrients, and toxicants, and performed a total of 50 analyses and comparisons each year. In 2010, the contents of proline, calcium, zinc, and vitamin C were significantly lower in the transgenic potato line 2-1, and the content of cysteine was significantly higher in the transgenic potato line 2-1. In 2011, the contents of threonine, serine, glycine, cysteine, isoleucine, leucine, tyrosine, phenylalanine, lysine, histidine, proline, zinc, vitamin B1, B6, pyridoxal, vitamin C, and vitamin E were significantly lower in the transgenic potato line 2-1. However, only the proline and zinc contents were significantly lower in both years, but within the database range. The contents of anti-nutrients and toxicants had no significant difference between the two potato lines.
When there is a statistically significant difference in the compositional analysis, the components of the differences should be evaluated based on the natural range of variation to determine its biological significance 18. The genetically modified potatoes line G2 and G3 expressed cryV gene were compared with the conventional potato Spunta. There was no significant difference between the transgenic potatoes and Spunta control potato in the proximate chemical composition, the level of glycoalkaloids, protease inhibitor activity and total phenol 19. The genetically modified potato, with high molecular weight insulin, and the conventional potato cultivars Agria, Linda, Granola, Solara, and two Désirée lines were analyzed using FIE-MS and GC-TOF-MS. Apart from targeted changes, the genetically modified potato appears to be substantially equivalent to traditional cultivars 20.
Numerous studies have pointed out that the compositions of potato vary significantly with different varieties and under different natural growing conditions. Three cultivars (Ditta, MN 1404 O5 and MN 2-1577 S1) were tested in phenology, yield, and tuber chemical composition. The Italian breeding clones (MN 1404 O5 and MN 2-1577 S1) deserve specific consideration due to their higher total yield and the contents of total protein and vitamin C under organic cultivation system than the cultivar Ditta 21. Organic cultivation can generate tubers with a distinct spectrum of minerals compared to that of conventionally grown tubers. The organically grown tubers contained more phosphorus, magnesium, and copper than the conventionally grown ones 22. Increased phosphorus availability in the soil can promote significant changes in the composition of potato tubers. It allowed the production of tubers with higher dry matter content, lower total sugar content, and a higher percentage of starch and protein 23. The nutrient composition and starch properties of eight potato cultivars (Electra, Fianna, Innovator, Mondial, Navigator, Panamera, Savanna, and Sifra) were evaluated. Fianna and Innovator potato cultivars had the highest dry mass, while Electra potato cultivar had the lowest. Fianna potato cultivar was ranked first in P, K, Mg, Zn, Cu, and Mn, compared to the other cultivars. Innovator and Navigator potato cultivars displayed the highest starch and amylose contents. There were significant differences in the composition and nutrient quality of the cultivars 24.
Genetically modified foods and feeds need to be registered and approved as admissible food and feed by the Taiwan Food and Drug Administration (TFDA) and the Council of Agriculture (COA). Up to the end of March 2020, a total of 150 genetically modified foods and a total of 147 genetically modified feeds got approval in Taiwan, but not including potato 25, 26. The transgenic potato line 2-1 was one of the genetically modified crops developed in Taiwan, and its safety is being continuously evaluated based on the principle of substantial equivalence.
In summary, we analyzed and compared the composition of the transgenic potato line 2-1 and the conventional potato line CK for two consecutive years, 2010 and 2011. Three contents of key components were found to be significantly different between the two types of potato tubers in two consecutive years. However, they were all within the reference range. Anti-nutrients and toxicants, which are potentially hazardous substances for humans and animals, had no significant difference between the two potato lines. The transgenic potato line 2-1 and the conventional potato line CK were substantially equivalent in composition.
The authors declare no conflicts of interest.
The study was supported by the grant from the Ministry of Health and Welfare, Taiwan under Contract No. FDA99-FS031 and DOH100-FDA-A3001. We would like to thank Dr. Su-May Yu and the Taiwan Agriculture Research Institute for potato samples.
| [1] | Mrudula Vasudevan, U., Jaiswal, A.K., Krishna, S. and Pandey, A., “Thermostable phytase in feed and fuel industries,” Bioresource Technology, 278,400-407, Apr. 2019. | ||
| In article | View Article PubMed | ||
| [2] | Kanter, M. and Elkin. C., “Potato as a source of nutrition for physical performance,” American Journal of Potato Research, 96, 201-205, Feb. 2019. | ||
| In article | View Article | ||
| [3] | Hong, Y.F., Liu, C.Y., Chen, K.J., Hour, A.L., Chan, M.T., Tseng, T.H., Chen, K.Y., Shaw, J.F. and Yu, S.M., “The sweet potato sporamin promoter confers high-level phytase expression and improves organic phosphorus acquisition and tuber yield of transgenic potato,” Plant Molecular Biology, 67(4), 347-361, Jul. 2008. | ||
| In article | View Article PubMed | ||
| [4] | FAO, GM food safety assessment tools for trainers, Food and Agriculture Organization of the United Nations Rome, 2008. [E-book] Available: http://www.fao.org/3/a-i0110e.pdf. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [5] | OECD, Consensus document on compositional considerations for new varieties of potatoes: key food and feed nutrients, anti-nutrients and toxicants, ENV/JM/MONO. 5, Organisation for Economic Cooperation and Development: Paris, France, 2002. | ||
| In article | |||
| [6] | Shimizu, M., “Purification and characterization of phytase from Bacillus subtilis (natto) N-77,” Bioscience Biothchnology and Biochemistry, 56(8), 1266-1269, Feb. 1992. | ||
| In article | View Article | ||
| [7] | Lin, H.Y., Chen, B.C., Chao, M.L., Chang, H.W., Lin, H.T. and Chu, W.S., “Comparison of compositions of imported genetically modified and organic soybeans purchased from Taiwan market,” Journal of Food and Nutrition Research, 7(10), 701-708, Oct. 2019. | ||
| In article | View Article | ||
| [8] | AOAC, Official methods of analysis of the Association of Official Analytic Chemists International. 19th edn., Method 920.44, 922.06, 930.05, 930.15, 944.12, 976.06, 981.15, 981.16, 984.26, 984.27, 985.29, 985.35, 986.27, 2012.09. AOAC International, Gaithersburg, Maryland. 2012. | ||
| In article | |||
| [9] | Bureau of Standards, Metrology & Inspection, MOEA, ROC. CNS 12634 N6223. Method of test for fruit and vegetable juice products-Determination of sugars by HPLC, Chinese National Standards, Taipei, Taiwan, 2006. [Online]. Available: http://www.cnsonline.com.tw/?node=result&typeof=common&locale=zh_TW. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [10] | Simpson, R.J., Neuberger, M.R. and Liu, T.Y., “Complete amino acid analysis of proteins from a single hydrolysate,” Journal of Biological Chemistry, 251(7), 1936-1940, Apr. 1976. | ||
| In article | |||
| [11] | Bognar, A., “Determination of vitamin B6 in food using high pressure liquid chromatography,” Zeitschrift für Lebensmittel-Untersuchung und Forschung, 181(3), 200-205, Sep.1985. | ||
| In article | View Article PubMed | ||
| [12] | Sotelo, A. and Serrano, B., “High-performance liquid chromatographic determination of the glycoalkaloids α-solanine and α-chaconine in 12 commercial varieties of Mexican potato,” Journal of Agricultural and Food Chemistry, 48(6), 2472-2475, May 2000. | ||
| In article | View Article PubMed | ||
| [13] | ILSI Research Foundation, ILSI crop composition database version 7.0. 2019. [Online]. Available: http://www.cropcomposition.org/query/index.html. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [14] | Fineli, Fineli food composition database release 20, 2019. [Online]. Available: https://fineli.fi/fineli/en/index. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [15] | DTU Fødevareinstituttet, Frida food database, 2019. [Online]. Available: https://frida.fooddata.dk/. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [16] | United States Department of Agriculture (USDA), USDA food data central, 2019. [Online]. Available: https://fdc.nal.usda.gov/. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [17] | Taiwan Food and Drug Administration (TFDA), Taiwan food nutrient database, 2017. [Online]. Available: https://consumer.fda.gov.tw/Food/TFND.aspx?nodeID=178. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [18] | Codex Alimentarius, Foods derived from modern biotechnology, Second Edition, World Health Organization, Food and Agriculture Organization of the United Nations, Rome, Italy, 2009. | ||
| In article | |||
| [19] | Sanhoty, R.E., El-Rahman, A.A.A. and Bögl, K.W., “Quality and safety evaluation of genetically modified potatoes Spunta with Cry V gene: Compositional analysis, determination of some toxins, antinutrients compounds and feeding study in rats,” Food. 48(1), 13-18, Feb. 2004. | ||
| In article | View Article PubMed | ||
| [20] | Catchpole, G.S., Beckmann, M., Enot, D.P., Mondhe, M., Zywicki, B., Taylor, J., Hardy, N., Smith, A., King, R.D., Kell, D.B., Fiehn, O. and Draper, J., “Hierarchical metabolomics demonstrates substantial compositional similarity between genetically modified and conventional potato crops,” Proceedings of the National Academy of Sciences of the United States of America, 102(40), 14458-14462, Oct. 2005. | ||
| In article | View Article PubMed | ||
| [21] | Lombardo, S., Monaco, A.L., Pandino, G., Parisi, B. and Mauromicale, G., “The phenology, yield and tuber composition of ‘early’ crop potatoes: A comparison between organic and conventional cultivation systems,” Renewable Agriculture and Food Systems, 28(1), 50-58, Mar. 2013. | ||
| In article | View Article | ||
| [22] | Lombardo, S., Pandino, G. and Mauromicale, G., “The mineral profile in organically and conventionally grown “early” crop potato tubers,” Scientia Horticulturae, 167, 169-173, Mar. 2014. | ||
| In article | View Article | ||
| [23] | Leonel, M., do Carmo, E.L., Fernandes, A.M., Soratto, R.P., Ebúrneo, J.A.M., Garcia, É.L. and Dos Santos, T.P.R., “Chemical composition of potato tubers: the effect of cultivars and growth conditions,” Journal of Food Science and Technology, 54, 2372-2378, May 2017. | ||
| In article | View Article PubMed | ||
| [24] | Ngobese, N.Z., Workneh, T.S., Alimi, B.A. and Tesfay, S., “Nutrient composition and starch characteristics of eight European potato cultivars cultivated in South Africa,” Journal of food composition and analysis, 55, 1-11, Jan. 2017. | ||
| In article | View Article | ||
| [25] | Taiwan Food and Drug Administration (TFDA), Current approvals of genetically modified foods in Taiwan, 2020. [Online]. Available: https://consumer.fda.gov.tw/Food/GmoInfoEn.aspx?nodeID=300. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [26] | COA, Current approvals of genetically modified feeds and feed additives in Taiwan, 2020. [Online]. Available: https://permit.coa.gov.tw/Feed/B0202/index.action. [Accessed Feb. 19, 2020]. | ||
| In article | |||
Published with license by Science and Education Publishing, Copyright © 2020 Bo-Chou Chen, Huan-Yu Lin, Jen-Tao Chen, Mei-Li Chao, Hsin-Tang Lin and Wen-Shen Chu
This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/
| [1] | Mrudula Vasudevan, U., Jaiswal, A.K., Krishna, S. and Pandey, A., “Thermostable phytase in feed and fuel industries,” Bioresource Technology, 278,400-407, Apr. 2019. | ||
| In article | View Article PubMed | ||
| [2] | Kanter, M. and Elkin. C., “Potato as a source of nutrition for physical performance,” American Journal of Potato Research, 96, 201-205, Feb. 2019. | ||
| In article | View Article | ||
| [3] | Hong, Y.F., Liu, C.Y., Chen, K.J., Hour, A.L., Chan, M.T., Tseng, T.H., Chen, K.Y., Shaw, J.F. and Yu, S.M., “The sweet potato sporamin promoter confers high-level phytase expression and improves organic phosphorus acquisition and tuber yield of transgenic potato,” Plant Molecular Biology, 67(4), 347-361, Jul. 2008. | ||
| In article | View Article PubMed | ||
| [4] | FAO, GM food safety assessment tools for trainers, Food and Agriculture Organization of the United Nations Rome, 2008. [E-book] Available: http://www.fao.org/3/a-i0110e.pdf. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [5] | OECD, Consensus document on compositional considerations for new varieties of potatoes: key food and feed nutrients, anti-nutrients and toxicants, ENV/JM/MONO. 5, Organisation for Economic Cooperation and Development: Paris, France, 2002. | ||
| In article | |||
| [6] | Shimizu, M., “Purification and characterization of phytase from Bacillus subtilis (natto) N-77,” Bioscience Biothchnology and Biochemistry, 56(8), 1266-1269, Feb. 1992. | ||
| In article | View Article | ||
| [7] | Lin, H.Y., Chen, B.C., Chao, M.L., Chang, H.W., Lin, H.T. and Chu, W.S., “Comparison of compositions of imported genetically modified and organic soybeans purchased from Taiwan market,” Journal of Food and Nutrition Research, 7(10), 701-708, Oct. 2019. | ||
| In article | View Article | ||
| [8] | AOAC, Official methods of analysis of the Association of Official Analytic Chemists International. 19th edn., Method 920.44, 922.06, 930.05, 930.15, 944.12, 976.06, 981.15, 981.16, 984.26, 984.27, 985.29, 985.35, 986.27, 2012.09. AOAC International, Gaithersburg, Maryland. 2012. | ||
| In article | |||
| [9] | Bureau of Standards, Metrology & Inspection, MOEA, ROC. CNS 12634 N6223. Method of test for fruit and vegetable juice products-Determination of sugars by HPLC, Chinese National Standards, Taipei, Taiwan, 2006. [Online]. Available: http://www.cnsonline.com.tw/?node=result&typeof=common&locale=zh_TW. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [10] | Simpson, R.J., Neuberger, M.R. and Liu, T.Y., “Complete amino acid analysis of proteins from a single hydrolysate,” Journal of Biological Chemistry, 251(7), 1936-1940, Apr. 1976. | ||
| In article | |||
| [11] | Bognar, A., “Determination of vitamin B6 in food using high pressure liquid chromatography,” Zeitschrift für Lebensmittel-Untersuchung und Forschung, 181(3), 200-205, Sep.1985. | ||
| In article | View Article PubMed | ||
| [12] | Sotelo, A. and Serrano, B., “High-performance liquid chromatographic determination of the glycoalkaloids α-solanine and α-chaconine in 12 commercial varieties of Mexican potato,” Journal of Agricultural and Food Chemistry, 48(6), 2472-2475, May 2000. | ||
| In article | View Article PubMed | ||
| [13] | ILSI Research Foundation, ILSI crop composition database version 7.0. 2019. [Online]. Available: http://www.cropcomposition.org/query/index.html. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [14] | Fineli, Fineli food composition database release 20, 2019. [Online]. Available: https://fineli.fi/fineli/en/index. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [15] | DTU Fødevareinstituttet, Frida food database, 2019. [Online]. Available: https://frida.fooddata.dk/. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [16] | United States Department of Agriculture (USDA), USDA food data central, 2019. [Online]. Available: https://fdc.nal.usda.gov/. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [17] | Taiwan Food and Drug Administration (TFDA), Taiwan food nutrient database, 2017. [Online]. Available: https://consumer.fda.gov.tw/Food/TFND.aspx?nodeID=178. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [18] | Codex Alimentarius, Foods derived from modern biotechnology, Second Edition, World Health Organization, Food and Agriculture Organization of the United Nations, Rome, Italy, 2009. | ||
| In article | |||
| [19] | Sanhoty, R.E., El-Rahman, A.A.A. and Bögl, K.W., “Quality and safety evaluation of genetically modified potatoes Spunta with Cry V gene: Compositional analysis, determination of some toxins, antinutrients compounds and feeding study in rats,” Food. 48(1), 13-18, Feb. 2004. | ||
| In article | View Article PubMed | ||
| [20] | Catchpole, G.S., Beckmann, M., Enot, D.P., Mondhe, M., Zywicki, B., Taylor, J., Hardy, N., Smith, A., King, R.D., Kell, D.B., Fiehn, O. and Draper, J., “Hierarchical metabolomics demonstrates substantial compositional similarity between genetically modified and conventional potato crops,” Proceedings of the National Academy of Sciences of the United States of America, 102(40), 14458-14462, Oct. 2005. | ||
| In article | View Article PubMed | ||
| [21] | Lombardo, S., Monaco, A.L., Pandino, G., Parisi, B. and Mauromicale, G., “The phenology, yield and tuber composition of ‘early’ crop potatoes: A comparison between organic and conventional cultivation systems,” Renewable Agriculture and Food Systems, 28(1), 50-58, Mar. 2013. | ||
| In article | View Article | ||
| [22] | Lombardo, S., Pandino, G. and Mauromicale, G., “The mineral profile in organically and conventionally grown “early” crop potato tubers,” Scientia Horticulturae, 167, 169-173, Mar. 2014. | ||
| In article | View Article | ||
| [23] | Leonel, M., do Carmo, E.L., Fernandes, A.M., Soratto, R.P., Ebúrneo, J.A.M., Garcia, É.L. and Dos Santos, T.P.R., “Chemical composition of potato tubers: the effect of cultivars and growth conditions,” Journal of Food Science and Technology, 54, 2372-2378, May 2017. | ||
| In article | View Article PubMed | ||
| [24] | Ngobese, N.Z., Workneh, T.S., Alimi, B.A. and Tesfay, S., “Nutrient composition and starch characteristics of eight European potato cultivars cultivated in South Africa,” Journal of food composition and analysis, 55, 1-11, Jan. 2017. | ||
| In article | View Article | ||
| [25] | Taiwan Food and Drug Administration (TFDA), Current approvals of genetically modified foods in Taiwan, 2020. [Online]. Available: https://consumer.fda.gov.tw/Food/GmoInfoEn.aspx?nodeID=300. [Accessed Feb. 19, 2020]. | ||
| In article | |||
| [26] | COA, Current approvals of genetically modified feeds and feed additives in Taiwan, 2020. [Online]. Available: https://permit.coa.gov.tw/Feed/B0202/index.action. [Accessed Feb. 19, 2020]. | ||
| In article | |||