The aim of this study is to add value to Cola cordifolia fruit from northern Côte d'Ivoire. Owing to its high carbohydrate content, Cola cordifolia could be a suitable substrate for research into fermentative flora for food industry. In this way, yeasts were isolated from Cola cordifolia pulp and screened for potential starters. Following screening, the best strains were identified using a molecular technique to determine the species involved. The results were used to select five (5) strains showing the best growth compared with the other strains tested. These strains belong to the Candida parapsilosis, Hanseniaspora uvarum and Pichia manshurica species. These strains could thus be used as potential starters in biotechnological applications. Cola cordifolia would be crucial to the development of yeast culture collections useful for controlled fermentations.
Côte d'Ivoire is the West Africa's top producer of fruit and vegetables. Every year in Côte d'Ivoire, large quantities of fruit are produced among which some are sold in Côte d'Ivoire, others are exported, and others are for local consumption only without resulting incomes. Therefore, a great part of the production is lost because many fruits are highly perishable 1. Over the past 20 years, Côte d'Ivoire has lost an average of 15% of its annual production, due to the lack of local processing units 1. Although some alternatives to direct consumption have already been implemented (jams, fruit concentrates, fruit juices, nectars, etc.), a large quantity of fruit is still left in the fields to rot or to be collected and then disposed of as waste. Among others, we can state Cola cordifolia, a wild fruit that generally grows in savannah regions. This fruit is poorly exploited, less known by Ivorians, from both nutritional and industrial point of view since its consumption remains seasonal. The production is abundant, but the product has never been taken into account as a means of adding value. In some countries, the alternative solution implemented has been to process most wild fruits through fermentation. Most often, the resulting product is wine derived from fruit, which is often distilled and has a variable alcohol concentration, or fruit vinegar 2. During these alcohol fermentation processes, several yeasts are involving whose identity and functional properties are unknowns. Knowledge of the functional properties of these yeasts will make it possible to select starter culture who will be able to optimize the alcoholic production of the Cola cordifolia fruit and other fruit notably cocoa fermentation. The aim of this study is to contribute to the valorization of Cola cordifolia fruits through the identification and screening of yeast strains involving of alcohol fermentation of this fruits to be used as a starter culture for the improvement and optimization of alcoholic fermentation.
The biological material used in this study is the fruit (pulp) of Cola cordifolia (Figure 1) from trees at the PELEFERO GON COULIBALY University in Korhogo (Côte d'Ivoire). The fruits have been harvested and sent to the University's laboratory for microbiological analysis.
Cola cordifolia beans (25 g) are diluted in 225 ml of peptone salt solution (0.1% (w/v) bactopeptone and 0.85% (w/v) NaCl). The solution thus prepared constitutes the stock solution, which undergoes successive decimal dilutions (10-1 to 10-4) with tryptone salt solution. A volume of 100 μL of each dilution has been streaked onto MYGP agar (3 g/L yeast extract, 3 g/L malt extract, 5 g/L bactopeptone and 10 g/L glucose) containing 100 mg/L chloramphenicol (Sigma). After inoculation, Petri dishes have incubated and yeast strains have morphologically been identified after 3 days of incubation at 30°C, then yeast cells have been observed fresh under a precision optical microscope (Zeiss Microlmaging GmbH 37081, Germany) at objective ˟100. Presumptive yeast isolates were stored in cryotubes containing MYGP broth supplemented with 20% glycerol at -20°C for subsequent testing 3.
3.2. Yeast ScreeningDepending on the test to perform, strains are grown overnight at 25◦C either on MYGP agar or in MYGP broth and then the cultures are used to inoculate either MYGP broth or specific media. For the latter, each strain is harvested by centrifugation (5000 rpm for 10 min), washed once in NaCl 0.9% (w/v) solution, re-suspended to Optical Density (OD) 600 of 1.0 in the same solution 4. Subsequently, each strain has been spotted (5 µL) in duplicate onto specific media.
The fermentative capacity of yeast strains isolated from Cola cordifolia pulp has been studied according to the method of 5 with a slight modification. From pre-culture of 24 hours, pure yeasts culture has been suspended in saline tryptone to get an optical density of 0.7 at 600 nm and 100 µL of this suspension have been used to inoculate 10 mL of YPG medium containing a Durham tube into essay tube. Then, the culture has been incubated at 30°C for 6 days, without agitation. Fermentative capacity has also been determined by measuring the gas production in Durham test. Yeasts usually oxidize sugars into ethanol with production of gas 6. This volume of gas and ethanol produced is related to the fermentative strength of strain 7.
The yeast biomass, taken with a sterile 1µL loop, has been added to a drop of 3% (v/v) H2O2 8. The development of bubbles has indicated positive activity.
A loopful (1 µL) of biomass of each strain has been streaked onto Chalk agar (yeast extract 3 g/L, glucose 10 g/L, calcium carbonate 3 g/L, agar 15 g/L) plates and has incubated for 7 d at 25 °C 9. The presence and extent of a clear halo around the yeast biomass has indicated the rate of acetic acid production.
To assess hydrogen sulphide production, 10 µL of each strain from the previously prepared YPD liquid has been inoculated on the BIGGY medium and kept for 2–3 days at 24 C, respectively. Visual scale has been used as a function of the increasing level of H2S produced 10, 11, 12, 13.
Each strain culture has been spotted onto Petri plates with a medium prepared by mixing the two following solutions: malt extract 3 g/L, yeast extract 3 g/L, peptone 5 g/L, glucose 10 g/L, NaCl 5 g/L, agar 20 g/L (separately sterilized), adjusted to pH 3.5 with 0.1 M HCl; and a skim milk solution (10% w/v) prepared and treated at 100◦C for 10 min. After incubation for 3 days at 25◦C, the presence of a clear halo around the yeast spot indicated protease activity 14.
Yeast strains have been grown in standard liquid medium containing 0.05% yeast extract; 0.3% casein peptone; 1% glucose at pH 5.6. To assess the influence of temperature on the growth of yeast isolates, 10 ml of standard liquid medium contained in a test tube has been inoculated with 100 µL of yeast pre-culture, OD600 = 0.7. The cultures have then been incubated for 72 h at temperatures ranging from 30 to 50°C. The influence of pH variations on the growth of yeast isolates has been analyzed in the same medium at different pH values (2.5; 4; 5 and 7) and has been incubated at 30°C. Yeast isolate growth has been determined by measuring the turbidity of the culture medium at 600 nm using a spectrophotometer.
An Ethanol assay has been carried out at the end of fermentation. Fermented molasse has been distilled to ethanol, using the powerful Quickfit/FC3/13 column distiller, 85 cm long and 4.45 cm in diameter (Fischer Scientific, Sweden) A temperature of 79°C has been maintained at the top of the column until all the alcohol in the fermented juice evaporated and condensed. The use of an alcoholmeter (Biobase, china) has enabled to determine Ethanol content. Three independent experiments have been performed.
Yeasts have been grown at 30 °C to the mid-log phase in YPD medium before harvesting. Yeast genomic DNA has been extracted using the classic phenol / chloroform method described by 15. The D1/D2 region of 26S rDNA has been PCR amplified as described by 16 using the eukaryotic universal primer gc-NL1 (5’ CGCCCGCCGCGCGCGGCGGGCGGGC GGGGGCCATATCAATAGCGGAGGA AAAG 3’) and the reverse primer LS2 (5’ ATTCCCAAACAACTCGACTC 3’). (5’ ATTCCCAAACAACTCGACTC 3’). The D1/D2 PCR program consisted to one cycle at 94°C for 3 min, followed by 30 cycles (95°C for 1 min, 52°C for 1 min, 72°C for 1 min), and a final extension at 72°C for 10 min. PCR-amplified D1/D2 regions of 26S rDNA were sequenced by BIOFIDAL (Lyon, France) using the Pseq D1/D2 primer (5’GGGCCATATCAATAAGC3’). Sequences have then been compared to the NCBI data Genbank using the BLAST program (http: //blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences showing a high percentage of identity (≥ 97 %) have been considered as belonging to the same species.
All measurements have been performed in triplicate. Statistical analyses of the data have been performed through Statistica version 7.1 software. Means have been compared through Tuckey's HSD test with a significance level of only 5% (p < 0 ,050).
Fifty-six (56) yeast isolates have been isolated from Cola cordifolia pulp. Table 1 shows the morphology, color, and texture of the colonies of the different strains grown on MYGP agar.
Among the 56 analyzed yeast strains for the fermentative capacity, only Sixteen (16) have shown a high fermentative capacity with gas amount above to 4 cm3. While five (5) isolates have a gas production between 1 and 4 cm3 and Thirty-Five (35) have gas production between 0 and 1 cm3 (Table 2).
All the yeasts isolates involving of Cola cordifolia pulp fermentation tested have the catalase and H2S production capacity. But the level of production is different from one yeast isolate to another. About protease activity, nine (9) have produced with high activity for five (5) isolates (YC 16, YC 21, YC 42, YC 46, YC 49). While only tree (3) yeasts isolates (YC 8, YC 53, YC 56) are able to produce acetic acid (Table 3).
Yeast isolates showed varying growth rates at different temperatures. In fact, all yeast isolates show a decrease in growth with increasing temperature. At 30°C, yeasts isolate growth ranged from 0.76 to 1.83. At 35°C, growth ranged from 0.40 to 1.54. At 40°C, growth ranged from 0.20 to 1.01. At 45°C, yeast isolate growth ranged from 0.15 to 0.82, and at 50°C from 0 to 0.35. Among the sixteen (16) isolates tested, ten (10) yeasts isolates (YC16, YC21, YC28, YC41, YC42, YC46, YC49, YC51, YC53 and YC56) showed the best growth at 30°C with an average optical density (OD) greater than 1. But the yeast isolate YC16 shows better growth (1.83) than all isolates tested at 30°C. In addition, yeasts isolate YC 28, YC 42, YC 56 and YC 46 maintain this good growth up to 35°C and YC 46 practically maintains this good growth at 40°C (Table 4).
The result of the growth of the 16 best yeasts isolates with a high fermentation power at different pH give two. The first group consists of yeast isolates (YC 3, YC 8, YC 21, YC 28, YC 40, YC 46, YC 53 and YC 56) with the maximum growth at pH 5. At this pH the yeast isolate YC 46 shows the best growth (2.04 ± 0.05). The second group consists of yeasts isolates (YC 54, YC 51, YC 49, YC 42, YC 41, YC 16, YC 6, and YC 5) which shows good growth at pH 4 and 5. At these pH the yeast isolate YC 54 shows the lowest microbial growth (0.66 ± 0.01) (Table 5).
Isolates YC16, YC21, YC42, YC46 and YC49 showed the best characteristics (high CO2 production, no acetic acid production, high catalytic activity, high protease activity, low H2S production, and good resistance to temperature and pH variation) for fermentation. These isolates have been selected for ethanol production and identified. The results of the statistical analysis showed a significant difference in ethanol production. Indeed, the production of strains YC16, YC42, YC46 and YC49 differed from that of strain YC28, which had the lowest ethanol production, while strain YC42 had the highest (Figure 2).
Molecular characterization of the five (5) selected isolates identified YC49, YC16 and YC46 as Pichia manshurica, YC21 as Candida parapsilosis and YC42 as Hanseniaspora uvarum
The first part of this study consisted in isolating yeasts from Cola cordifolia pulp. Thus, isolation on MYGP medium yielded 56 isolates: YC1 to YC56. The study of phenotypic characteristics has enabled us to distinguish four colonies that have the same criteria: small, Convex, White, Smooth/Glossy colonies with regular outlines, large Convex, White, Matt/opaque colonies with irregular outlines, small Convex, White, Matt/opaque colonies with irregular contours and Convex, Cream-colored, Smooth/Glossy colonies with regular contours. These results are identical to those of 17 who states that the characteristics of pure yeast strains lie in size, color, surface appearance, contour appearance, relief, consistency and transparency. After purification, a study of the microscopic characteristics of the pure isolates showed that the cells of the different isolates are: elongated or oval in shape; large, medium or small in size. These observations testify the definition proposed by 18 who distinguishes yeasts, which belong to the fungi group, by their unicellular character.
The second part of the study consisted in screening yeast isolates to select the best ones for use as starters for ethanol production. In fact, a strain's ability to offer improved technological and functional performance is a key property in its selection as a potential starter 19. Thus, among the 56 yeasts analyzed for their fermentative capacity, sixteen (16) showed a high fermentative capacity with a CO2 volume greater than 4 cm3. These results are similar to those of 20 who showed that among 743 strains, 113 yeast strains were selected for their high fermentative capacity with a CO2 volume greater than 4 cm3. These yeast strains are likely to produce high quantities of ethanol, since during alcoholic fermentation, the quantity of carbon dioxide (CO2) would correspond to the quantity of ethanol produced 6.
The majority of strains studied have not produced acetic acid. Acetic acid is one of the compounds that have an impact on the sensory profile of wine, determining its quality. An acetic acid concentration of 0.7–1.1 g/L is not considered pleasant, tasteful; the maximum acceptable limit for volatile acidity in most wines is 1.2 g/L of acetic acid 21, 22. Strains producing little or no acetic acid are the most interesting, tasteful. From this point of view, most of the strains studied are interesting.
Results from the catalase test gave information about the ability of strains to cope with oxidative stress and to perform better during fermentation 23. All of the strains tested in this study were catalase positive to various extents and in agreement with other authors 24, 25. However, the strains YC16, YC21, YC42, YC46 and YC 49 with the highest catalytic activity are the most interesting for alcoholic fermentation.
The screening of yeast strains that produce zero or low H2S is particularly important for fermentation since there will be no sulfite formation during fermentation. The difference in H2S production obtained in this study has been confirmed by several authors 14, 25, 26.
The strains grew well at the different temperatures and pH levels studied. The ability of the strains to grow at high temperatures and low pH levels enables them to adapt to harsh environments. Their resistance to different temperatures corroborates the results of 27 who reported similar optimal temperatures for yeast. In addition, the strains studied had their best growth at pH 5, which differs from the results of 19 indicating that the best yeast growths at the pH level of cocoa pulp is between 3 and 4.
With regard to ethanol production, the alcohol contents of isolates YC 46, YC16, YC 49 belonging to the species Pichia manshurica and YC 42 belonging to the species Hanseniaspora uvarum have shown no significant difference. However, the ethanol produced by these species is different from that produced by Candida parapsilosis species. Production of these strains therefore varies from 5.39 to 6.81%. It should be noted that the production of these strains is higher than that of other strains isolated during cocoa fermentation by 19 whose highest ethanol production is 4.19 %. In addition, the five best strains are non-Saccharomyces strains, which are known to modulate the aroma profile during alcoholic fermentation 28, 29.
Isolates YC16, YC21, YC42, YC46 and YC49 showed the best characteristics (high CO2 production, no acetic acid production, high catalytic activity, high protease activity, low H2S production, and good resistance to temperature and pH variation) for fermentation. The growth of these yeast isolates under stress conditions confirms the ability of these yeast strains to be used as starters in many food processes, mainly in the fruit fermentation process.
Fifty-six (56) pure isolates were isolated from Cola cordifolia pulp. Among these fifty-six (56) yeasts isolates, five (5) isolates coded YC16, YC21, YC42, YC46 and YC49 showed the best characteristics, namely high CO2 production, no acetic acid production, high catalytic and protease activity, low H2S production and good resistance to temperature and pH variation. These strains belong to three species: Pichia manshurica (YC49, YC16 and YC46), Candida parapsilosis (YC21) and Hanseniaspora uvarum (YC42). Thus, these five (5) isolates with interesting technological properties could be used as starters in biotechnological applications.
Authors have declared that no competing interests exist.
This work was carried out in collaboration among all authors. Author SS designed and supervised the study. Authors SS and KM managed and performed the experimental and statistical analysis. Authors SL and ML wrote the protocol and wrote the first draft of the manuscript. Authors SS and SY managed the literature searches. All authors read and approved the final manuscript.
| [1] | FIRCA (2016). Présentation des filières fruitières. La filière du Progrès n°13 du 1er trimestre, Côte-d’Ivoire, 46 pages. | ||
| In article | |||
| [2] | Ayed L., M’hir S. and Hamdi M. (2020). Aspects microbiologiques, biochimiques et fonctionnels des boissons fermentées de légumes et de fruits. Journal de la chimie, 20 (2): 1-12. | ||
| In article | |||
| [3] | Samagaci, L., Ouattara, H. G., Goualié, B. G. and Niamke, S. L. (2014). Growth capacity of yeasts potential starter strains under cocoa fermentation stress conditions in Ivory Coast. Emirates Journal of Food and Agriculture, 26(10), 861-870. | ||
| In article | View Article | ||
| [4] | Sidari, R., Ženišová, K., Tobolková, B., Belajová, E., Cabicarová, T., Buˇcková., M., Puškárová, A., Planý, M., Kuchta, T and Pangallo, D. (2021). Wine yeasts selection : Laboratory characterization and protocol review, Microorganisms, 9(11), 1-27. | ||
| In article | View Article | ||
| [5] | Dung N. T. P and Phong. X.H. (2013). Screening thermo- and ethanol tolerant bacteria for ethanol fermentation. American Journal of Microbiological Research, 1(2), 25-31. | ||
| In article | View Article | ||
| [6] | Pongracz G., Weiser H. and Matzinger D. (1971). Tocopherols- Antioxydant. Fat Science Technology, 97(3), 90-104. | ||
| In article | View Article | ||
| [7] | Dung N. T. P., Pornthap T. and Huynh X. P. (2012). Screening useful isolated yeasts for ethanol fermentation at high temperature. International Journal of Applied Science et Technology, 2 (4): 65-71. | ||
| In article | |||
| [8] | Bautista-Gallego, J., Rodríguez-Gómez, F., Barrio, E., Querol, A., Garrido-Fernandez, A. and Arroyo-López, F.N. (2011). Exploring the yeast biodiversity of green table olive industrial fermentations for technological applications. International Journal of Food Microbiology, 147(2), 89–96. | ||
| In article | View Article | ||
| [9] | Lemaresquier, H., Gainvors, A., Lequart, C., Charlemagne, B., Frézier, V. and Belarbi, A. (1995). Sélection de levures oenologiques á activité clarifiante. Revue Francaise d'œnologie 154, 23–29. | ||
| In article | |||
| [10] | Capece, A., Pietrafesa, R., Siesto, G., Romaniello, R., Condelli, N. and Romano, P. (2019). Selected indigenous Saccharomyces Cerevisiae strains as profitable strategy to preserve typical traits of Primitivo wine. Fermentation, 5(4), 1-17. | ||
| In article | View Article | ||
| [11] | Esteve-Zarzoso, B., Belloch, C., Uruburu, F. and Querol, A. (1999). Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. International Journal of Systematic Bacteriology.49(1), 329–337. | ||
| In article | View Article | ||
| [12] | Hallinan, C.P., Saul, D.J. and Jiranek, V. (1999). Differential utilisation of sulfur compounds for H2S liberation by nitrogen-starved wine yeasts. Australian Journal of Grape and Wine Research, 5(3), 82–90. | ||
| In article | View Article | ||
| [13] | Mendes-Ferreira, A., Mendes-Faia, A. and Leão, C. (2002). Survey of Hydrogen Sulphide Production by Wine Yeasts. Journal of Food Protection, 65(6), 1033–1037. | ||
| In article | View Article | ||
| [14] | Comitini, F., Gobbi, M., Domizio, P., Romani, C., Lencioni, L., Mannazzu, I. and Ciani, M. (2011). Selected non-Saccharomyces wine yeasts in controlled multistarter fermentations with Saccharomyces cerevisiae. Food Microbiology, 28(5), 873–882. | ||
| In article | View Article | ||
| [15] | Hoffman C. S. (2001). Preparation of Yeast DNA. Current Protocols in Molecular Biology. 39, 1–13. | ||
| In article | View Article | ||
| [16] | Hamdouche Y., Guehi T., Durand N., Kedjebo K. B., Montet D. and Meile J. C. (2015). Dynamics of microbial ecology during cocoa fermentation and drying towards the identification of molecular markers. Food Control, 48, 117-122, | ||
| In article | View Article | ||
| [17] | Tokindrainy A. J. C. (2015). Isolement et identification des levures du fruit du bibacier de la region vakinankaratra. Memoire de master pour l’obtention de diplôme d’étude approfondie en sciences de la vie. Université d’Antanariovo, Madagascar, P.42. | ||
| In article | |||
| [18] | Guiraud J.P. (1998). Microbiologie alimentaire. Dunod, Paris, P.696. | ||
| In article | |||
| [19] | Holzapfel W. H. (2002). Appropriate starter culture technologies for small-scale fermentation in developing countries. International journal of Food Microbiology, 75 (3): 197-212. | ||
| In article | View Article | ||
| [20] | Koffi O., Samagaci L., Goualie B. and Niamke S. (2018). Screening of potential yeast starters with high ethanol production for a small-scale cocoa fermentation in Ivory Coast. Food and Environment Safety, 7 (2): 113 – 130. | ||
| In article | |||
| [21] | Lambrechts, M.G. and Pretorius, I.S. (2000). Yeast and its importance to wine aroma-A review. South African Journal of Enology and Viticulture, 21(1), 97–129. | ||
| In article | View Article | ||
| [22] | OIV. (2010). International Code of Oenological Practices; Office Internationale de la Vigne et du Vin : Paris, France. | ||
| In article | |||
| [23] | Bisson, L.F., Karpel, J.E., Ramakrishnan, V. and Joseph, L. (2007). Functional genomics of wine yeast Saccharomyces cerevisiae. Advances in Food and Nutrition Research 53, 65–121. | ||
| In article | View Article | ||
| [24] | Mestre Furlani, M.V., Maturano, J.P., Combina, M., Mercado, L.A., Toro, M.E. and Vazquez, F. (2017). Selection of non-Saccharomyces yeasts to be used in grape musts with high alcoholic potential: A strategy to obtain wines with reduced ethanol content. FEMS Yeast Research, 17(2), 1–10. | ||
| In article | View Article | ||
| [25] | Barbosa, C., Lage, P., Esteves, M., Chambel, L., Mendes-Faia, A. and Mendes-Ferreira, A. (2018). Molecular and phenotypic characterization of Metschnikowia pulcherrima strains from Douro wine region. Fermentation, 4(1), 1-19. | ||
| In article | View Article | ||
| [26] | Garavaglia, J., de Cassia de Souza Schneider, R., Camargo Mendes, S.D., Welke, J.E., Alcaraz-Zini, C., Bastos Caramão, E. and Valente, P. (2015). Evaluation of Zygosaccharomyces bailii BCV 08 as a co-starter in wine fermentation for the improvement of ethyl esters production. Microbiological Research, 173, 59–65. | ||
| In article | View Article | ||
| [27] | Leveau J. Y. et Bouix M. (1993). Microbiologie industrielle. Les micro-organismes d’intérêt industriel. Edition Lavoisier TEC et DOC, Paris (France), 612 pages. | ||
| In article | |||
| [28] | Fleet, G.H. (2003). Yeast interactions and wine flavour. International Journal of Food Microbiology, 86(1-2), 11–22 | ||
| In article | View Article | ||
| [29] | Ženišová, K.; Cabicarová, T.; Sidari, R.; Kolek, E.; Pangallo, D.; Szemes, T.; Kuchta, T. (2021). Effects of co-fermentation with Lachancea thermotolerans or Metschnikowia pulcherrima on concentration of aroma compounds in Pinot Blanc wine. Journal of Food and Nutrition Research, 60(1), 87–91. | ||
| In article | |||
Published with license by Science and Education Publishing, Copyright © 2024 Soumahoro Souleymane, Kouame Maimouna Liliane, Samagaci Lamine, Soro Yade Rene and Marc Lemaire
This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit
https://creativecommons.org/licenses/by/4.0/
| [1] | FIRCA (2016). Présentation des filières fruitières. La filière du Progrès n°13 du 1er trimestre, Côte-d’Ivoire, 46 pages. | ||
| In article | |||
| [2] | Ayed L., M’hir S. and Hamdi M. (2020). Aspects microbiologiques, biochimiques et fonctionnels des boissons fermentées de légumes et de fruits. Journal de la chimie, 20 (2): 1-12. | ||
| In article | |||
| [3] | Samagaci, L., Ouattara, H. G., Goualié, B. G. and Niamke, S. L. (2014). Growth capacity of yeasts potential starter strains under cocoa fermentation stress conditions in Ivory Coast. Emirates Journal of Food and Agriculture, 26(10), 861-870. | ||
| In article | View Article | ||
| [4] | Sidari, R., Ženišová, K., Tobolková, B., Belajová, E., Cabicarová, T., Buˇcková., M., Puškárová, A., Planý, M., Kuchta, T and Pangallo, D. (2021). Wine yeasts selection : Laboratory characterization and protocol review, Microorganisms, 9(11), 1-27. | ||
| In article | View Article | ||
| [5] | Dung N. T. P and Phong. X.H. (2013). Screening thermo- and ethanol tolerant bacteria for ethanol fermentation. American Journal of Microbiological Research, 1(2), 25-31. | ||
| In article | View Article | ||
| [6] | Pongracz G., Weiser H. and Matzinger D. (1971). Tocopherols- Antioxydant. Fat Science Technology, 97(3), 90-104. | ||
| In article | View Article | ||
| [7] | Dung N. T. P., Pornthap T. and Huynh X. P. (2012). Screening useful isolated yeasts for ethanol fermentation at high temperature. International Journal of Applied Science et Technology, 2 (4): 65-71. | ||
| In article | |||
| [8] | Bautista-Gallego, J., Rodríguez-Gómez, F., Barrio, E., Querol, A., Garrido-Fernandez, A. and Arroyo-López, F.N. (2011). Exploring the yeast biodiversity of green table olive industrial fermentations for technological applications. International Journal of Food Microbiology, 147(2), 89–96. | ||
| In article | View Article | ||
| [9] | Lemaresquier, H., Gainvors, A., Lequart, C., Charlemagne, B., Frézier, V. and Belarbi, A. (1995). Sélection de levures oenologiques á activité clarifiante. Revue Francaise d'œnologie 154, 23–29. | ||
| In article | |||
| [10] | Capece, A., Pietrafesa, R., Siesto, G., Romaniello, R., Condelli, N. and Romano, P. (2019). Selected indigenous Saccharomyces Cerevisiae strains as profitable strategy to preserve typical traits of Primitivo wine. Fermentation, 5(4), 1-17. | ||
| In article | View Article | ||
| [11] | Esteve-Zarzoso, B., Belloch, C., Uruburu, F. and Querol, A. (1999). Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. International Journal of Systematic Bacteriology.49(1), 329–337. | ||
| In article | View Article | ||
| [12] | Hallinan, C.P., Saul, D.J. and Jiranek, V. (1999). Differential utilisation of sulfur compounds for H2S liberation by nitrogen-starved wine yeasts. Australian Journal of Grape and Wine Research, 5(3), 82–90. | ||
| In article | View Article | ||
| [13] | Mendes-Ferreira, A., Mendes-Faia, A. and Leão, C. (2002). Survey of Hydrogen Sulphide Production by Wine Yeasts. Journal of Food Protection, 65(6), 1033–1037. | ||
| In article | View Article | ||
| [14] | Comitini, F., Gobbi, M., Domizio, P., Romani, C., Lencioni, L., Mannazzu, I. and Ciani, M. (2011). Selected non-Saccharomyces wine yeasts in controlled multistarter fermentations with Saccharomyces cerevisiae. Food Microbiology, 28(5), 873–882. | ||
| In article | View Article | ||
| [15] | Hoffman C. S. (2001). Preparation of Yeast DNA. Current Protocols in Molecular Biology. 39, 1–13. | ||
| In article | View Article | ||
| [16] | Hamdouche Y., Guehi T., Durand N., Kedjebo K. B., Montet D. and Meile J. C. (2015). Dynamics of microbial ecology during cocoa fermentation and drying towards the identification of molecular markers. Food Control, 48, 117-122, | ||
| In article | View Article | ||
| [17] | Tokindrainy A. J. C. (2015). Isolement et identification des levures du fruit du bibacier de la region vakinankaratra. Memoire de master pour l’obtention de diplôme d’étude approfondie en sciences de la vie. Université d’Antanariovo, Madagascar, P.42. | ||
| In article | |||
| [18] | Guiraud J.P. (1998). Microbiologie alimentaire. Dunod, Paris, P.696. | ||
| In article | |||
| [19] | Holzapfel W. H. (2002). Appropriate starter culture technologies for small-scale fermentation in developing countries. International journal of Food Microbiology, 75 (3): 197-212. | ||
| In article | View Article | ||
| [20] | Koffi O., Samagaci L., Goualie B. and Niamke S. (2018). Screening of potential yeast starters with high ethanol production for a small-scale cocoa fermentation in Ivory Coast. Food and Environment Safety, 7 (2): 113 – 130. | ||
| In article | |||
| [21] | Lambrechts, M.G. and Pretorius, I.S. (2000). Yeast and its importance to wine aroma-A review. South African Journal of Enology and Viticulture, 21(1), 97–129. | ||
| In article | View Article | ||
| [22] | OIV. (2010). International Code of Oenological Practices; Office Internationale de la Vigne et du Vin : Paris, France. | ||
| In article | |||
| [23] | Bisson, L.F., Karpel, J.E., Ramakrishnan, V. and Joseph, L. (2007). Functional genomics of wine yeast Saccharomyces cerevisiae. Advances in Food and Nutrition Research 53, 65–121. | ||
| In article | View Article | ||
| [24] | Mestre Furlani, M.V., Maturano, J.P., Combina, M., Mercado, L.A., Toro, M.E. and Vazquez, F. (2017). Selection of non-Saccharomyces yeasts to be used in grape musts with high alcoholic potential: A strategy to obtain wines with reduced ethanol content. FEMS Yeast Research, 17(2), 1–10. | ||
| In article | View Article | ||
| [25] | Barbosa, C., Lage, P., Esteves, M., Chambel, L., Mendes-Faia, A. and Mendes-Ferreira, A. (2018). Molecular and phenotypic characterization of Metschnikowia pulcherrima strains from Douro wine region. Fermentation, 4(1), 1-19. | ||
| In article | View Article | ||
| [26] | Garavaglia, J., de Cassia de Souza Schneider, R., Camargo Mendes, S.D., Welke, J.E., Alcaraz-Zini, C., Bastos Caramão, E. and Valente, P. (2015). Evaluation of Zygosaccharomyces bailii BCV 08 as a co-starter in wine fermentation for the improvement of ethyl esters production. Microbiological Research, 173, 59–65. | ||
| In article | View Article | ||
| [27] | Leveau J. Y. et Bouix M. (1993). Microbiologie industrielle. Les micro-organismes d’intérêt industriel. Edition Lavoisier TEC et DOC, Paris (France), 612 pages. | ||
| In article | |||
| [28] | Fleet, G.H. (2003). Yeast interactions and wine flavour. International Journal of Food Microbiology, 86(1-2), 11–22 | ||
| In article | View Article | ||
| [29] | Ženišová, K.; Cabicarová, T.; Sidari, R.; Kolek, E.; Pangallo, D.; Szemes, T.; Kuchta, T. (2021). Effects of co-fermentation with Lachancea thermotolerans or Metschnikowia pulcherrima on concentration of aroma compounds in Pinot Blanc wine. Journal of Food and Nutrition Research, 60(1), 87–91. | ||
| In article | |||