Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children
Maša Primec1,
, Martina Klemenak2, Irene Aloisio3, Mario Gorenjak4, 5, Diana Di Gioia3, Dušanka Mičetić-Turk6, Tomaž Langerholc1
1Department of Microbiology, Biochemistry, Molecular Biology and Biotechnology, Faculty of Agriculture and Life Sciences, University of Maribor, Pivola 10, 2311 Hoče, Slovenia
2Department of Pediatrics, University Clinical Center Maribor, Ljubljanska ulica 5, 2000 Maribor, Slovenia
3Department of Agricultural Sciences, University of Bologna, viale Fanin 42, 40127 Bologna, Italy
4Department of Animal Science, Faculty of Agriculture and Life Sciences, University of Maribor, Pivola 10, 2311 Hoče, Slovenia
5Centre for Human Molecular Genetics and Pharmacogenomics and Department of Biochemistry and Nutrition, both Faculty of Medicine, Taborska ulica 8, 2000 Maribor, Slovenia
6Department of Pediatrics, Faculty of medicine, University of Maribor, Taborska ulica 8, 2000 Maribor, Slovenia
Abstract
Background: Knowledge about the interplay between diet, microbiota and short-chain fatty acids (SCFAs) so far exists. Moreover, raising evidence suggests their influence on the pathogenesis of the celiac disease (CD). Objective: Our aim was to study and evaluate differences in the composition of selected bacterial groups and SCFAs in faeces of healthy and CD children. Methods: The study included 41 children with CD, 8 newly discovered, not treated children (ND) and 33 children on gluten-free diet for more than 1 year (GFD) and 17 healthy children as a Control group. Bacterial communities and SCFAs in faecal samples were determined by real-time PCR and HPLC analysis, respectively. Results: There were no statistically significant differences between GFD and ND patients. GFD patients compared to Controls had significantly lower Lactobacillus spp. (p = 0.027) and Enterobacteriaceae family group (p = 0.003), but higher propionic acid (p = 0.034). Acetic (p = 0.027) and propionic acid (p = 0.014) were significantly higher in ND patients compared to Controls. Lactobacillus spp. negatively correlated with total SCFAs in the Control and the ND group. In ND and GFD patients, Lactobacillus spp. negatively correlated with Clostridium sensu stricto cluster I. A very strong positive correlation (p = 0.002) between Enterobacteriaceae family and Bacteroides fragilis was found in GFD patients. Conclusions: Changes in microbiota and SCFAs are clearly related to the pathogenesis of CD. As being potential pro-inflammatory agents in CD, acetic and propionic acid may serve as important disease-related markers. Their origin in relation to Lactobacillus and Bifidobacterium is debatable and still need to be further investigated. Enterobacteriaceae family might not be directly addressed to pathogenesis of CD.
Keywords: celiac disease, children, gluten-free diet, microbiota, short-chain fatty acids
Copyright © 2016 Science and Education Publishing. All Rights Reserved.Cite this article:
- Maša Primec, Martina Klemenak, Irene Aloisio, Mario Gorenjak, Diana Di Gioia, Dušanka Mičetić-Turk, Tomaž Langerholc. Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children. International Journal of Celiac Disease. Vol. 4, No. 3, 2016, pp 95-101. http://pubs.sciepub.com/ijcd/4/3/6
- Primec, Maša, et al. "Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children." International Journal of Celiac Disease 4.3 (2016): 95-101.
- Primec, M. , Klemenak, M. , Aloisio, I. , Gorenjak, M. , Gioia, D. D. , Mičetić-Turk, D. , & Langerholc, T. (2016). Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children. International Journal of Celiac Disease, 4(3), 95-101.
- Primec, Maša, Martina Klemenak, Irene Aloisio, Mario Gorenjak, Diana Di Gioia, Dušanka Mičetić-Turk, and Tomaž Langerholc. "Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children." International Journal of Celiac Disease 4, no. 3 (2016): 95-101.
| Import into BibTeX | Import into EndNote | Import into RefMan | Import into RefWorks |
At a glance: Figures
1. Introduction
The main role in the development of intestinal microbiota has been addressed to food, even at birth, when the first phase of intestinal colonization of microorganisms occurs [1]. Microbial colonization is a complex process, depending on the interactions between intestinal microbiota, endogenic (host) and exogenic factors, which concomitantly affect the quantity and the composition of the microbiota itself [2, 3, 4, 5, 6]. Despite some speculations about the actual diet effect on infant gastrointestinal microbial composition [7, 8], by the age of three, microbiota achieves its peak in changing the composition and structure and further it remains relatively stable [1, 6, 9].
Worldwide increasing frequency of the disease has put celiac disease (CD) on the top of the most common food-related disorders, affecting children as well as adults [10, 11]. In fact, a complex mixture of genetic and environmental factors contribute to the disease pathology characterized by chronic immune-mediated inflammation and abnormal microbiota composition [11, 12, 13, 14]. Gluten-free diet (GFD) has so far been the only available effective CD treatment, but doubts about its effectiveness have arisen [15, 16, 17]. Moreover, the restoration of the microbiota after GFD may not be completed, even after some time, as it has been shown in in vitro [18] and in vivo [19] studies, which led to the conclusion that GFD itself also seems to have an effect on the microbiota by changing its composition [20]. There is an ongoing debate about the role of microbiota in CD patients, whether it is the cause or the consequence of the disease [10, 19, 21, 22, 23, 24]. Nevertheless, it is believed that CD patients tend to accumulate higher numbers of Gram negative to Gram positive bacteria compared to healthy subjects [19].
SCFAs are organic acids, produced as end products in the microbial fermentation of non-digestible carbohydrates. Highest concentration of SCFAs are found in caecum and large intestine. SCFAs production clearly depends on the diet, i.e. quantity of available fibers, as well as upon the microbiota composition. Increasing amount of evidence suggests profound effects of SCFAs on host health and homeostasis (reviewed in den Besten et al. [25] and Sun et al. [26]). However, SCFAs quantification and correlation to microbiota in CD studies has been rare and consequently provided limited insight into the disease pathology.
Therefore, our aim was to study differences in the composition of SCFAs and some representative bacterial groups between ND, GFD and healthy children. By statistical comparison between the measured parameters we aimed to evaluate significance of microbiota and SCFAs as prediction parameters for the disease characterization and progress during the GFD treatment.
2. Materials and Methods
The research study was conducted within a group of patients that were included in another study (for details see Klemenak et al. [27]. The study was registered at https://www.clinicaltrials.gov (registration number: NCT02244047).
Based on the available faecal samples obtained at the beginning of the study (baseline), three different groups of patients were selected and their faeces was analysed: healthy patients (Control; n = 17), newly discovered (not treated) CD patients (ND; n = 8) and patients, who were on gluten – free diet for more than 1 year (GFD; n = 33).
2.1. Inclusion / Exclusion CriteriaPatients within this study were children aged between 1 and 19 years. The GFD group included children that strictly adhered to the GFD ranging from 1 to 15 years, 7.8 years on average. For the detailed inclusion / exclusion criteria please refer to the study of Klemenak et al. [27].
2.2. Collection of Faecal SamplesChildren's parents or caregivers were given instructions about faecal sampling and transportation procedure. Immediately after defecation, faecal samples were put into a standard laboratory collecting cup for faecal samples, transported in iced cold bags to the laboratory, aliquoted and stored at -80 °C until the analysis.
2.3. Derivatization of SCFAs and HPLC AnalysisDerivatization and HPLC analysis of SCFAs was performed according to Torii et al. [28]. Briefly, faeces were weighed (0.2 – 0.5 g) and put into a 15 mL centrifuge tube. 5.0 mL of 70% ethanol was added, homogenized and centrifuged at 2500 rpm for 10 min at room temperature. The supernatant was collected for further analysis. SCFAs were derivatized into acid hydrazides and separated by YMC-Pack FA 250 x 6 mm ID column (YMC, Kyoto, Japan) under isocratic conditions using Waters 2695 XE Separation Module (Waters Corporation, Milford, MA 01757, US). SCFAs derivatives were detected by diode-array detector at 400 nm and quantified by peak area integration. Four SCFAs were measured during the HPLC analysis (acetic, propionic, n-butyric) and 2-ethylbutyric acid was used as an internal standard. All consumables used during derivatization and solvents for HPLC analysis were from Sigma-Aldrich Co. LLC (St. Louis, MO, US). Results were expressed for acetic, propionic and n-butyric acid in μmol / g of wet weight faeces.
2.4. DNA ExtractionDNA extraction of 200 mg of faeces was carried out using the QIAamp DNA Stool Mini Kit (Qiagen, West Sussex, UK), according to manufacturer’s instructions with a slight modification. An additional incubation at 95°C for 10 min of the faecal sample with the lysis buffer was added to the standard protocol, to improve the bacterial cell rupture [29]. The purity and the concentration of the extracted DNA were determined by measuring the ratio of the absorbance at 260 and 280 nm (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Switzerland).
2.5. Quantitative PCR (qPCR)The quantification of selected microbial groups of intestinal microbiota (Bidobacterium spp., Lactobacillus spp., Bacteroides fragilis, Clostridium sensu stricto or cluster I and the total Enterobacteriaceae) was determined by real-time PCR. The assays were performed using Fast SYBR® Green Master Mix (Applied Biosystems, according to manufacturer’s instructions). Standard curve construction and data elaboration expressed in Log CFU/g faeces were performed according to Aloisio et al. [29]. Optimized concentrations of primers, primer sequences and annealing temperature for the quantification of Bidobacterium spp., Lactobacillus spp., Bacteroides fragilis were reported in Aloisio et al. [29]. Primers have been chosen by evaluating the best Ct/ΔRn ratio and their specificity has been verified before the analysis. Enterobacteriaceae family were evaluated using 400 nM of each primers – Eco 1457F (CATTGACGTTACCCGCAGAAGAAGC) and Eco 1652R (CTCTACGAGACTCAAGCTGC) – at 60°C as annealing temperature [30]. Clostridium sensu stricto were evaluated using 200 nM of each primers – CI-F1 (TACCHRAGGAGGAAGCCAC) and CI-F2 (GTTCTTCCTAATCTCTACGCAT) – at 60°C as annealing temperature [31].
2.6. Statistical AnalysisData were analyzed by SPSS Statistics 22.0 software (IBM Inc., Armonk, New York) using non-parametrical Mann-Whitney U-Test after Shapiro-Wilk test of normality. Correlations of variables were determined using Spearman correlations. P value ≤ 0.05 or 0.01 in correlation analyses was considered statistically significant.
3. Results
Due to the insufficient amount of faecal material, only a subset (58 children) from the study of Klemenak et al. [27] were included in this study and grouped as mentioned before in the Methodology section.
Faeces was collected from ND, GFD and Control children, followed by quantification and statistical analysis of SCFAs and selected bacterial groups (Figure 1. and Figure 2., respectively). There were no statistically significant differences between any of the parameters in the ND patients compared to the GFD patients. In the GFD group compared to the Controls, propionic acid values were significantly higher (p = 0.034), in contrast to Lactobacillus spp. (p = 0.027) and Enterobacteriaceae (p = 0.003) that were significantly lower. Acetic and propionic acid values were significantly higher (p = 0.027 and p = 0.014, respectively) in the ND patients compared to the Controls. Moreover, Bifidobacterium spp. values were almost statistically significantly higher (p = 0.059) in the ND patients compared to the Controls (data not shown).
Download as
Download as
Furthermore, potential correlations between SCFAs and bacteria in each individual group were separately examined. In healthy controls, total SCFAs strongly positively correlated with acetic, propionic and butyric acid (all p = 0.000). Propionic acid strongly positively correlated with acetic (p = 0.001) and n-butyric acid (p = 0.000). The latter had a positive correlation (p = 0.049) with acetic acid. Lactobacillus spp. had a negative correlation (p = 0.02) to acetic acid and total SCFAs (p = 0.01). Moreover, a strong negative correlation (p = 0.002) between Lactobacillus spp. and propionic acid was observed (Table 1).
Table 1. Correlation coefficients and p values between SCFAs and bacteria in healthy patients (Control group)
In ND patients, n-butyric acid had a positive correlation to acetic and propionic acid (both p = 0.01). Total SCFAs had a strong positive correlation to n-butyric and propionic acid (p = 0.002 and 0.000, respectively), followed by acetic acid (p = 0.03). Lactobacillus spp. negatively correlated with propionic acid, total SCFAs and Clostridium sensu stricto (all p = 0.04) (Table 2).
In GFD patients, a strong positive correlation between all SCFAs and consequently total SCFAs (all p = 0.000) was observed. Total SCFAs were close to negative correlation with Lactobacillus spp. (p = 0.051). There was a positive correlation (p = 0.02) between acetic acid and Clostridium sensu stricto. The later had a negative correlation (p = 0.02) to Lactobacillus spp. A strong positive correlation (p = 0.002) between Enterobacteriaceae family and Bacteroides fragilis was found (Table 3).
Table 3. Correlation coefficients and p values between SCFAs and bacteria in patients on GFD for more than 1 year (GFD group)
4. Discussion
The active phase of the CD is mainly described as a non – treated disease or a disease not responding to the GFD treatment. In contrast, the non-active phase of the disease is illustrated as a disease in remission, mostly due to the GFD adherence [32, 33]. Clearly, to study the pathogenesis of gastrointestinal diseases, knowledge about the microbiota composition and its relationship to the immune system is crucial.
The most consistent findings in active CD disease patients, when compared to healthy subjects, are lower levels of Lactobacillus [20, 34] and Bifidobacterium [32, 35, 36]. Nevertheless, it should be taken into consideration, that these two genera should not be generalized, as some of the Lactobacillus [22] and Bifidobacterium [20, 36, 37] species may be specific for CD patients and / or healthy subjects. In fact, the diversity in Bifidobacterium and Lactobacillus species in CD patients has also been illustrated by contradictory results (reviewed in de Sousa Moraes et al. [10]). Moreover, in our results, the ND compared to the Control group did not reveal any statistically significant difference between bacterial groups, except for Bifidobacterium spp., which in our case was surprisingly almost significantly higher (p = 0.059) in the ND than in the Control group. However, a limitation in the number of ND patients in our study should also be taken in consideration.
Unlike other researchers, we did not find any statistically significant differences in Bacteroides [32, 34, 36, 38, 39], Enterobacteriaceae family group [13] and Clostridium sensu stricto between the ND and the Control group. Next, we evaluated differences between the GFD in relation to the ND and Control groups. By comparing the GFD patients with the ND patients, we found no statistically significant differences between the measured bacteria. However, differences were observed between the GFD and the Control group. The GFD group had significantly lower levels of Lactobacillus spp. than the Control group, which is in concordance with other studies [19, 40]. In our study, the GFD group had significantly lower levels of Enterobacteriaceae family, compared to the healthy Control, but not the ND group. Many controversies can be found in the literature about the role of Enterobacteriaceae in CD. While in one study [40] this bacterial family tended to increase in the symptom free GFD patients relative to the healthy subjects, another study [13] identified members of this family to be abundant only in patients with active disease on a normal diet. Since other research groups also found Enterobacteriaceae to be higher in active [41], non-active (treated with GFD) [19] disease or even in both cases [34], this may lead to the conclusion that this family might not be directly related to the pathogenesis of the CD. Namely, healthy subjects increased the number of Enterobacteriaceae (Escherichia coli) [18, 42] during the shift from normal to the GFD diet. Concomitantly, the number of so called potentially harmless and beneficial bacteria (Bifidobacterium spp. and Lactobacillus spp.) in both studies decreased, which may lead to some open questions about what really causes the changes in microbiota.
Furthermore, an interesting observation was found in the ND and the GFD patients. In both groups, there was a negative correlation between Lactobacillus spp. and Clostridium sensu stricto, cluster I, suggesting diet independent relationship. In fact, Clostridium spp. is a very large group of bacteria that has also been detected in human gastrointestinal samples. Some of them belong to the Clostridium sensu stricto, cluster I. Although someone may speculate about it, their members are generally illustrated as pathogenic [43]. A very strong positive correlation between Enterobacteriaceae and Bacteroides fragilis was found in the GFD group. Since the previous studies have found out increased levels of possibly harmful Bacteroides [19, 32, 34, 35, 36, 38] and Enterobacteriaceae family [13, 32, 34, 40] in CD patients (active and / or non-active disease), these two groups of bacteria may actually correlate with each other and their correlations could have an important role, at least in the gastrointestinal tract of CD patients. Further investigations, regarding previously mentioned observations and potential relationship between the two bacterial groups are needed.
Gut microbiota is responsible for the production of SCFAs. Since microbiota dysbiosis occurs in CD patients, SCFAs profile is generally expected to change. In terms of SCFAs, acetic and propionic acid were significantly higher in the ND compared to the Control group, which is in agreement with previous studies [21, 44, 45]. According to the study of Tjellström et al. [45], acetic acid may have pro-, in contrast to butyric acid, which may have anti-inflammatory effects. However, butyric acid in our study was not recognized to differentiate ND patients from healthy children. Furthermore, propionic acid was significantly higher in the GFD group compared to the healthy Controls, which was also a case in two other studies [21, 44]. Unlike some researchers [19, 21, 45, 46], who found total SCFAs to be higher in CD patients compared to healthy subjects, we did not observe any statistically significant differences in total SCFAs between all patient groups. Interestingly, Lactobacillus spp. negatively correlated with total SCFAs in the Control and the ND group and almost negatively correlated (p = 0.051) in the GFD group. Moreover, in our study Lactobacillus spp. also had a negative correlation to propionic acid in the Control and the ND group, which altogether may not support the suggestion of Di Cagno et al. [46] about Lactobacillus and Bifidobacterium being responsible for an increase in large intestine SCFAs synthesis.
5. Conclusions
A complex interplay between diet, microbiota, immune system and individual factors may synergistically contribute to the disease pathology. Acetic and propionic acid are pro-inflammatory-related agents in CD and could be as useful marker of stage activity of the disease and prosperity of the treatment. Nevertheless, their origin in relationship to Lactobacillus and Bifidobacterium need to be further assessed. Enterobacteriaceae family might not be directly connected to the pathogenesis of CD. We believe that, apart from SCFAs and microbiota, a more complex input data model is needed to elucidate the trigger-response relationships in CD.
Acknowledgements
We thank Sarah Jurjevec for her help in the laboratory analysis. We are also grateful to the parents of healthy and CD children for cooperation in the research.
Funding
The research was partially funded by Slovenian research agency programme P1-0164 ''Raziskave za zagotavljanje varne hrane in zdravja''.
Statement of Competing Interests
The authors have no competing interests.
Ethical Approval
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Informed Consent
Informed consent was obtained from all individual participants included in the study.
List of Abbreviations
CD – celiac disease
SCFAs – short-chain fatty acids
ND - newly discovered, not treated children
GFD – gluten-free diet.
References
| [1] | Voreades, N., Kozil, A., Weir, T. L. Diet and the development of the human intestinal microbiome. Frontiers in microbiology, 5, 494. 2014. | ||
In article | |||
| [2] | Palmer, C., Bik, E. M., DiGiulio, D. B., Relman, D. A., Brown, P. O.. Development of the human infant intestinal microbiota. PLoS biology, 5(7), e177. 2007 | ||
In article | |||
| [3] | Mueller, N. T., Bakacs, E., Combellick, J., Grigoryan, Z., & Dominguez-Bello, M. G. The infant microbiome development: mom matters. Trends in Molecular Medicine, 21(2), 109-117. 2014. | ||
In article | |||
| [4] | Mshvildadze, M., Neu, J. The infant intestinal microbiome: friend or foe? Early human development, 86 Suppl 1, 67-71. 2010. | ||
In article | |||
| [5] | Matamoros, S., Gras-Leguen, C., Le Vacon, F., Potel, G., de La Cochetiere, M.-F. Development of intestinal microbiota in infants and its impact on health. Trends in microbiology, 21(4), 167-73. 2013. | ||
In article | |||
| [6] | Arrieta, M.-C., Stiemsma, L. T., Amenyogbe, N., Brown, E. M., Finlay, B. The intestinal microbiome in early life: health and disease. Frontiers in immunology, 5, 427. 2014. | ||
In article | |||
| [7] | Hopkins, M. J., Macfarlane, G. T., Furrie, E., Fite, A., Macfarlane, S. Characterisation of intestinal bacteria in infant stools using real-time PCR and northern hybridisation analyses. FEMS microbiology ecology, 54(1), 77-85. 2005. | ||
In article | |||
| [8] | Penders, J., Vink, C., Driessen, C., London, N., Thijs, C., & Stobberingh, E. E. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS microbiology letters, 243(1), 141-7. 2005. | ||
In article | |||
| [9] | Gerber, G. K. The dynamic microbiome. FEBS letters, 588(22), 4131-9. 2014. | ||
In article | |||
| [10] | de Sousa Moraes, L. F., Grzeskowiak, L. M., de Sales Teixeira, T. F., Gouveia Peluzio, M. do C. Intestinal microbiota and probiotics in celiac disease. Clinical microbiology reviews, 27(3), 482-9. 2014. | ||
In article | |||
| [11] | Cenit, M. C., Olivares, M., Codoñer-Franch, P., Sanz, Y. Intestinal Microbiota and Celiac Disease: Cause, Consequence or Co-Evolution? Nutrients, 7(8), 6900-23. 2015. | ||
In article | |||
| [12] | Leonard, M. M., Camhi, S., Huedo-Medina, T. B., Fasano, A. Celiac Disease Genomic, Environmental, Microbiome, and Metabolomic (CDGEMM) Study Design: Approach to the Future of Personalized Prevention of Celiac Disease. Nutrients, 7(11), 9325-36. 2015. | ||
In article | |||
| [13] | Sánchez, E., Donat, E., Ribes-Koninckx, C., Fernández-Murga, M. L., Sanz, Y. Duodenal-mucosal bacteria associated with celiac disease in children. Applied and environmental microbiology, 79(18), 5472-9. 2013. | ||
In article | |||
| [14] | Pallav, K., Kabbani, T., Tariq, S., Vanga, R., Kelly, C. P., Leffler, D. A. Clinical utility of celiac disease-associated HLA testing. Digestive diseases and sciences, 59(9), 2199-206. 2014. | ||
In article | |||
| [15] | Tuire, I., Marja-Leena, L., Teea, S., Katri, H., Jukka, P., Päivi, S., … Katri, K. Persistent duodenal intraepithelial lymphocytosis despite a long-term strict gluten-free diet in celiac disease. The American journal of gastroenterology, 107(10), 1563-9. 2012. | ||
In article | |||
| [16] | Wacklin, P., Kaukinen, K., Tuovinen, E., Collin, P., Lindfors, K., Partanen, J., … Mättö, J. The duodenal microbiota composition of adult celiac disease patients is associated with the clinical manifestation of the disease. Inflammatory bowel diseases, 19(5), 934-41. 2013. | ||
In article | |||
| [17] | O’Hara, A. M., Shanahan, F. The gut flora as a forgotten organ. EMBO reports, 7(7), 688-93. 2006. | ||
In article | |||
| [18] | De Palma, G., Nadal, I., Collado, M. C., Sanz, Y. Effects of a gluten-free diet on gut microbiota and immune function in healthy adult human subjects. The British journal of nutrition, 102(8), 1154-60. 2009. | ||
In article | |||
| [19] | Di Cagno, R., De Angelis, M., De Pasquale, I., Ndagijimana, M., Vernocchi, P., Ricciuti, P., … Francavilla, R. Duodenal and faecal microbiota of celiac children: molecular, phenotype and metabolome characterization. BMC microbiology, 11, 219. 2012. | ||
In article | |||
| [20] | Sanz, Y., Sánchez, E., Marzotto, M., Calabuig, M., Torriani, S., Dellaglio, F. Differences in faecal bacterial communities in coeliac and healthy children as detected by PCR and denaturing gradient gel electrophoresis. FEMS immunology and medical microbiology, 51(3), 562-8. 2007. | ||
In article | |||
| [21] | Tjellström, B., Stenhammar, L., Högberg, L., Fälth-Magnusson, K., Magnusson, K.-E., Midtvedt, T., … Norin, E. Gut microflora associated characteristics in children with celiac disease. The American journal of gastroenterology, 100(12), 2784-8. 2005. | ||
In article | |||
| [22] | Sanz, Y., De Pama, G., & Laparra, M. Unraveling the ties between celiac disease and intestinal microbiota. International reviews of immunology, 30(4), 207-18. 2011. | ||
In article | |||
| [23] | Marasco, G., Di Biase, A. R., Schiumerini, R., Eusebi, L. H., Iughetti, L., Ravaioli, F., … Festi, D. Gut Microbiota and Celiac Disease. Digestive diseases and sciences, 61(6), 1461-72. 2016. | ||
In article | |||
| [24] | Wacklin, P., Laurikka, P., Lindfors, K., Collin, P., Salmi, T., Lähdeaho, M.-L., … Kaukinen, K. Altered duodenal microbiota composition in celiac disease patients suffering from persistent symptoms on a long-term gluten-free diet. The American journal of gastroenterology, 109(12), 1933-41. 2014. | ||
In article | |||
| [25] | den Besten, G., van Eunen, K., Groen, A. K., Venema, K., Reijngoud, D.-J., Bakker, B. M. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. Journal of lipid research, 54(9), 2325-40. 2013. | ||
In article | |||
| [26] | Sun, Y., O’Riordan, M. X. D. Regulation of bacterial pathogenesis by intestinal short-chain Fatty acids. Advances in applied microbiology, 85, 93-118. 2013. | ||
In article | |||
| [27] | Klemenak, M., Dolinšek, J., Langerholc, T., Di Gioia, D., Mičetić-Turk, D. Administration of Bifidobacterium breve Decreases the Production of TNF-α in Children with Celiac Disease. Digestive diseases and sciences, 60(11), 3386-92. 2015. | ||
In article | |||
| [28] | Torii, T., Kanemitsu, K., Wada, T., Itoh, S., Kinugawa, K., Hagiwara, A. Measurement of short-chain fatty acids in human faeces using high-performance liquid chromatography: specimen stability. Annals of clinical biochemistry, 47(Pt 5), 447-52. 2010. | ||
In article | |||
| [29] | Aloisio, I., Mazzola, G., Corvaglia, L. T., Tonti, G., Faldella, G., Biavati, B., Di Gioia, D. Influence of intrapartum antibiotic prophylaxis against group B Streptococcus on the early newborn gut composition and evaluation of the anti-Streptococcus activity of Bifidobacterium strains. Applied microbiology and biotechnology, 98(13), 6051-60. 2014. | ||
In article | |||
| [30] | Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. T. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied and environmental microbiology, 70(6), 3575-81. 2004. | ||
In article | |||
| [31] | Song, Y., Liu, C., Finegold, S. M. Real-time PCR quantitation of clostridia in feces of autistic children. Applied and environmental microbiology, 70(11), 6459-65. 2004. | ||
In article | |||
| [32] | Collado, M. C., Donat, E., Ribes-Koninckx, C., Calabuig, M., Sanz, Y. Specific duodenal and faecal bacterial groups associated with paediatric coeliac disease. Journal of clinical pathology, 62(3), 264-9. 2009. | ||
In article | |||
| [33] | Murch, S. Recent Advances in Celiac Disease. Indian journal of pediatrics. 2016. | ||
In article | |||
| [34] | Nadal, I., Donat, E., Donant, E., Ribes-Koninckx, C., Calabuig, M., Sanz, Y. Imbalance in the composition of the duodenal microbiota of children with coeliac disease. Journal of medical microbiology, 56(Pt 12), 1669-74. 2007. | ||
In article | |||
| [35] | De Palma, G., Nadal, I., Medina, M., Donat, E., Ribes-Koninckx, C., Calabuig, M., Sanz, Y. Intestinal dysbiosis and reduced immunoglobulin-coated bacteria associated with coeliac disease in children. BMC Microbiology, 10(1), 63. 2010. | ||
In article | |||
| [36] | Collado, M. C., Calabuig, M., Sanz, Y. Differences between the fecal microbiota of coeliac infants and healthy controls. Current issues in intestinal microbiology, 8(1), 9-14. 2007. | ||
In article | |||
| [37] | Collado, M. C., Donat, E., Ribes-Koninckx, C., Calabuig, M., Sanz, Y. Imbalances in faecal and duodenal Bifidobacterium species composition in active and non-active coeliac disease. BMC microbiology, 8(1), 232. 2008. | ||
In article | |||
| [38] | Schippa, S., Iebba, V., Barbato, M., Di Nardo, G., Totino, V., Checchi, M., … Conte, M. A distinctive “microbial signature” in celiac pediatric patients. BMC Microbiology, 10(1), 175. 2010. | ||
In article | |||
| [39] | De Palma, G., Cinova, J., Stepankova, R., Tuckova, L., Sanz, Y. Pivotal Advance: Bifidobacteria and Gram-negative bacteria differentially influence immune responses in the proinflammatory milieu of celiac disease. Journal of leukocyte biology, 87(5), 765-78. 2010. | ||
In article | |||
| [40] | Lorenzo Pisarello, M. J., Vintiñi, E. O., González, S. N., Pagani, F., Medina, M. S. Decrease in lactobacilli in the intestinal microbiota of celiac children with a gluten-free diet, and selection of potentially probiotic strains. Canadian journal of microbiology, 61(1), 32-7. 2015. | ||
In article | |||
| [41] | Sánchez, E., Ribes-Koninckx, C., Calabuig, M., Sanz, Y. Intestinal Staphylococcus spp. and virulent features associated with coeliac disease. Journal of clinical pathology, 65(9), 830-4. 2012. | ||
In article | |||
| [42] | Sanz, Y. Effects of a gluten-free diet on gut microbiota and immune function in healthy adult humans. Gut microbes, 1(3), 135-7. 2010. | ||
In article | |||
| [43] | Rajilić-Stojanović, M., de Vos, W. M. The first 1000 cultured species of the human gastrointestinal microbiota. FEMS microbiology reviews, 38(5), 996-1047. 2014. | ||
In article | |||
| [44] | Nistal, E., Caminero, A., Vivas, S., Ruiz de Morales, J. M., Sáenz de Miera, L. E., Rodríguez-Aparicio, L. B., Casqueiro, J. Differences in faecal bacteria populations and faecal bacteria metabolism in healthy adults and celiac disease patients. Biochimie, 94(8), 1724-9. 2012. | ||
In article | |||
| [45] | Tjellström, B., Högberg, L., Stenhammar, L., Fälth-Magnusson, K., Magnusson, K.-E., Norin, E., … Midtvedt, T. Faecal short-chain fatty acid pattern in childhood coeliac disease is normalised after more than one year’s gluten-free diet. Microbial ecology in health and disease, 24. 2013. | ||
In article | |||
| [46] | Di Cagno, R., Rizzello, C. G., Gagliardi, F., Ricciuti, P., Ndagijimana, M., Francavilla, R., … De Angelis, M. Different fecal microbiotas and volatile organic compounds in treated and untreated children with celiac disease. Applied and environmental microbiology, 75(12), 3963-71. 2009. | ||
In article | |||
sciepub.com
Quick Submission













In article
CiteULike
Delicious


