Isolation of Enterohaemorrhagic Escherichia coli O104 Strains from Raw Meat Products in the North West Province, South Africa
Collins Njie Ateba1,
, Boitumelo Itiel Marumo1
1Department of Biological Sciences, School of Environmental and Health Sciences, Faculty of Agriculture, Science and Technology, North West University, Mafikeng Campus, Private Bag X2046, Mmabatho, South Africa
Abstract
Enterohaemorrhagic E. coli (EHEC) are Shiga toxin-producing E. coli strains that possess unique pathogenic properties and are characterized by certain seropathotypes that are frequently associated with outbreaks or sporadic cases of human infections. Although EHEC strains belonging to the serotype O104:H4 has rarely been associated with human diseases in the past, outbreaks of infections caused by this organism resulted to HUS and bloody diarrhoea in humans in countries that have advanced public health facilities. The aim of this study was to isolate E. coli O104 strains from meat samples obtained from supermarkets and retail shops in the North West Province, South Africa. A further objective was to determine the identities of the isolates using Gram staining, preliminary biochemical tests (oxidase test, Triple Sugar Iron (TSI) test, citrate utilization and Sorbitol fermentation test) and confirmatory (API 20E and PCR analysis) assays. A total of nineteen meat samples were collected from four butcheries and shops in the study area and Sorbitol MacConkey agar was used for selective isolation of bacteria. A total of 304 presumptive colonies were subjected to identification tests for E. coli. Large proportions (65.5% to 93%) of these isolates were oxidase negative; fermented the sugars in the TSI medium; utilized citrate and fermented sorbitol. On the contrary only a small proportion (27.3%) of the isolates produced hydrogen sulphide gas. Based on patterns obtained for the biochemical profiles of the isolates 102 (33.6%) were positively identified as E. coli. All the 304 E. coli isolates were subjected to specific PCR designed to amplify thewzxO104 gene fragment that facilitates identification of E. coli O104 strains and a total of 52 isolates were positively identified. Despite the fact that not all samples were positive for the pathogen, the presence of E. coli O104 strains in some of the meat samples was of great concern. These bacteria cells have the potential to cause severe health effects on consumers if present in undercooked food products.
At a glance: Figures
Keywords: Enterohaemorrhagic E. coli (EHEC), E. coli O104 strains, food contamination, beef, diarrhoea, wzxO104gene
Journal of Food and Nutrition Research, 2014 2 (6),
pp 288-293.
DOI: 10.12691/jfnr-2-6-4
Received May 09, 2014; Revised May 29, 2014; Accepted June 10, 2014
Copyright © 2013 Science and Education Publishing. All Rights Reserved.Cite this article:
- Ateba, Collins Njie, and Boitumelo Itiel Marumo. "Isolation of Enterohaemorrhagic Escherichia coli O104 Strains from Raw Meat Products in the North West Province, South Africa." Journal of Food and Nutrition Research 2.6 (2014): 288-293.
- Ateba, C. N. , & Marumo, B. I. (2014). Isolation of Enterohaemorrhagic Escherichia coli O104 Strains from Raw Meat Products in the North West Province, South Africa. Journal of Food and Nutrition Research, 2(6), 288-293.
- Ateba, Collins Njie, and Boitumelo Itiel Marumo. "Isolation of Enterohaemorrhagic Escherichia coli O104 Strains from Raw Meat Products in the North West Province, South Africa." Journal of Food and Nutrition Research 2, no. 6 (2014): 288-293.
| Import into BibTeX | Import into EndNote | Import into RefMan | Import into RefWorks |
1. Introduction
E. coli is a prominent member of the gastrointestinal tract of their hosts and are released into the environment by human and animal dejections when appropriate hygiene and sanitary practices are not implemented [1, 2]. It is estimated that up 4% of all cultivable bacteria in the colon are E. coli and the fact that these bacteria species are most often present in the microbiota of the environment they are therefore used as indicators of faecal pollution [1, 2, 3]. Despite the fact that a number of non-pathogenic E. coli strains are known to maintain the physiological state of the gastrointestinal tract, enhance digestion and defend the host against other enteric pathogens, some strains possess and express a variety of virulence determinants [4, 5, 6]. Consequently, a number of E. coli strains are currently known to cause diseases ranging from diarrhoea, haemolytic colitis (HC), haemorrhagic uraemic syndrome (HUS) and septicaemia in humans [4, 5, 7, 8, 9]. Enterohaemorrhagic E. coli (EHEC) are Shiga toxin-producing E. coli strains that possess unique pathogenic properties [4], and are characterized by certain seropathotypes that are frequently associated with outbreaks or sporadic cases of human infections [10, 11, 12, 13, 14]. The host range of EHEC strains are domestic animals and colonized animals usually shed the bacteria through their faeces [15]. This therefore increases the chances of contamination [16] and the consumption of contaminated food of animal origin is known to be a source of human EHEC infections [17, 18]. EHEC have thus been isolated from water, sewage, soil, manure, animal faeces, sprouts and fresh produce [12, 15, 19, 20, 21, 22]. Despite the fact that contaminated vegetables and sprouted seeds are considered the main vehicles for transmitting EHEC strains, meat and meat products have also been linked to some outbreaks caused by diarrheagenic E. coli in many parts of the world [23, 24]. In South Africa and the North West Province in particular, E. coli O157:H7 strains have been extremely investigated mainly due to its severe concern resulting from the serious clinical outcomes of infections caused by the pathogen [25-34][25].
Although E. coli serotype O104:H4 has rarely been associated with human diseases in the past [35], outbreaksof infections caused by thisstrain was responsible for the clinical signs of HUS and bloody diarrhoea in humans in Germany, France, UK, Canada and the USA [8,9,22,36-42]. Moreover, epidemiological analysis involving pulsed-field gel electrophoresis, semi-automated rep-PCR and optical mapping analysis revealed that isolates from the different countries had similar genetic profiles [39]. It is therefore suggested that the isolates from Germany might have been transmitted through food sources, water or by person-to-person contact to the other countries.
To the best of our knowledge, there is currently no available information on the occurrence of E. coli O104 strains in humans, animals, environmental samples and food products in South Africa. Given the fact that E. coli O104:H4 has been associated with diseases in countries with more advanced public health care facilities there is a need to screen for the presence of these pathogens in South African food products. In this study we present the first investigation on the occurrence of enterohaemorrhagic E. coli O104 strains in raw meat products. This was designed to determine whether these meat products may serve as a potential source for the transmission of the organisms to humans.
2. Materials and Methods
2.1. Sample CollectionA total of 19 rawmeat samples including beef, mince, and lamb were purchased from butcheries in Mafikeng and local retail shops in Mabule and Legabane respectively. The samples were properly labeled and transported on ice to the laboratory for selective isolation of E. coli. Table 1 indicates the type and number of samples collected from the different areas.
Upon arrival in the laboratory, 2 grams of each meat sample was washed in 10mL of 2% (w/v) peptone water. Ten-fold serial dilutions were prepared using sterile 2% (w/v) peptone water. Aliquots of 100µL from each dilution was spread-plated on sorbitol MacConkey agar and used for the detection of lactose-fermenting (red colonies) and non-lactose fermenting (white colonies).Plates were incubated aerobically at 37°C for 24 hours. Sixteen presumptive colonies from each plate were purified by sub-culturing on sorbitol MacConkey agar and the plates were incubated aerobically at 37°C for 24 hours. These isolates were stored at room temperature and used for bacteria identification tests.
2.3. Determination of Cellular MorphologyThe morphology of presumptive isolates was determined using standard methods [43]. Gram negativerod shaped bacteria were retained for further identification tests.
2.4. Triple Sugar Iron TestTriple Sugar Iron agar (Biolab, Merck Diagnostics, South Africa) was used to differentiate members of the Enterobacteriaceae from other Gram-negative bacteria. The test was used to access the ability of isolates to breakdown the three sugars glucose, lactose and sucrose that are present at concentrations of 0.1%, 1.0% and 1.0%. Pure cultures were stab-inoculated into the butt and streaked on the surface of the slant of the TSI agar. The tubes were then incubated at 37°C for 24 hours. Results were read and isolates were classified based on the ability to ferment the sugars with or without the production of gas, colour change from red to yellow and the production of hydrogen sulphide (H2S) [44].
2.5. Oxidase TestThis test was performed using the Test Oxidase reagentTM (PL. 390) as recommended by the manufacturer (Mast Diagnostics, Neston, and Wirral, UK). Positive results were recorded based on the production of a purple or blue colour and vice versa.
2.6. Simmons Citrate Utilization TestIsolated pure colonies were streaked on the slant and a stab inoculated into the butt of Simmons Citrate agar (Fluka, Biochemika).The tubes were incubated at 37°C for 24 hours and observed for colour change from green to blue which was recorded aspositive results.
2.7. Sorbitol Fermentation TestIsolates wereinoculatedinto a test tube containing phenol red sorbitol broth and incubated at 37°C for 24 hours. Positive results were based on a colour change from red to yellow [45].
2.8. Biochemical CharacterizationThe isolates were examined for biochemical properties of E. coli using the API 20E system (Bio-Mérieux, Marcy l’Etoile, France) according to the manufacturer’s instructions. The 20 biochemical tests performed included o-nitrophenyl-β-D-galactosidase, lysine decarboxylase, ornithine decarboxylase, urease production, citrate utilization, deamination of phenylalanine, malonate utilization, Esculin hydrolysis, fermentation of arabinose, xylose, adonitol, rhamnose, cellobiose, melibiose, sucrose, trehalose, raffinose and glucose; production of indole and acetoin and testing for the production of cytochrome oxidase. Results were read with or without the addition of reagents and the API web software was used to determine the identities of isolates based on the indices that were generated.
2.9. DNA ExtractionGenomic DNA was extracted from all presumptive isolates using a modified cell boiling method [46]. To carry out the procedure 500μl of sterile water was placed in 1.5 mL microfuge tubes and pure cultures of the isolates were transferred into the tubes. The tubes were vortexed vigorously to prepare a homogenous suspension. The cell suspension was incubated at 100°C in a heating block (Biorad, Digital dry bath) for 15 minutes and this was followed by centrifugation for 2 minutes at 13500 rpm. After centrifugation, the tube was placed on ice for 5 minutes and the supernatant was transferred to a new tube. An aliquot of 5μL of this supernatant was used for PCR analysis.
2.10. Identification of Suspected E. coli O104 Isolates by PCR AnalysisA PCR-based protocol was used to screen isolates for the presence of enterohaemorrhagic E. coli O104 strains through the amplification of the wzxO104 gene fragments [47]. Specific primer sequences O104F (TGTCGCGCAAAGAATTTCAAC) and O104R (AAAATCCTTTAAACTATACGCCC) [47] were utilized and amplifications were performed using a C1000 Touch TM Thermal Cycler (Bio-Rad, Johannesburg, South Africa. Standard 25 µL PCR mixtures that contained 12.5µl master mix (Thermo scientific PMM), 8.5µL of nuclease free water, 1.5µL of loading buffer, 0.5µL oligonucleotide both primers and finally, 2µL of DNA template were prepared. All the reagents were Fermentas, USA products and were obtained from Inqaba Biotec Ltd, Sunnyside- South Africa. PCR amplification was performed according to the following in-laboratory optimized conditions: initial denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 64°C for 1 minute, extension at 72°C for 1 minute 30 seconds and final extension at 72°C for 5 minutes. The PCR products were stored at 4°C before separation by electrophoresis.
2.11. Electrophoresis of PCR ProductsThe PCR products were resolvedby electrophoresis on a 2% (w/v) agarose gel. A horizontal Pharmacia biotech equipment system (model Hoefer HE 99X; Amersham Pharmacia biotech, Sweden) was used to carry out electrophoresis and this was run for 2h at 80V using 1x TAE buffer (40mM Tris, 1mM EDTA and 20mM glacial acetic acid, PH 8.0). Each gel contained a 100bp DNA molecular weight marker (Fermentas, USA). The gels were stained in ethidium bromide (0.001µg/ml) for 15 minutes and the amplicons were visualized under U.V light at a wavelength of 420nm [48]. A Gene Genius Bio Imaging System (Syngene, Synoptics; UK) was used to capture the image using GeneSnap (version 6.00.22) software. GeneTools (version 3.07.01) software (Syngene, Synoptics; UK) was used to analyze the images in order to determine the relative sizes of the amplicons.
3. Results and Interpretation
3.1. Detection of E. coli O104:H4 Using Preliminary and Confirmation testsA total of nineteen meat samples that comprised samples from beef, mince, and lamb were collected from four butcheries in Mafikeng, four shops in Mabule and three shops in Legabane. Sixteen characteristic isolates from each sample were subjected to bacteria identification tests for E. coli (Gram staining, oxidase test, Citrate utilisation test, TSI and API 20E test). Detailed results of the number of isolates that were positive for the different tests are shown in Table 2 and Table 3. All the isolates were Gram negative rods and therefore satisfied that presumptive characteristic for E. coli. A large proportion (93%) of these isolates was oxidase negative; fermented the sugars in the TSI medium; utilized citrate and fermented the carbohydrate sorbitol. On the contrary, only a small proportion (27.3%) of the isolates produced hydrogen sulphide gas (Table 2). Based on patterns obtained for the biochemical profiles of the isolates 102 (33.6%) were positively identified as E. coli (Table 3).
Table 3. Number of isolates that were positively identified as E. coli O104 based on specific PCR analysis
A total of 304 E. coli isolates were screened for characters of enterohaemorrhagic E. coliO104 strains by specific PCR amplification of the wzxO104 genetic marker. Table 3 indicates the number of isolates that were positive for the target gene from the different sampling areas. Overall a total of 52 isolates were positively identified based on the presence of the wzxO104. Despite this, not all samples were positive for this pathogen. However the detection of the recently emerged enteroaggregative E. coli O104 strain in raw meat samples in the North West Province, South Africa was a cause for concern. On the basis of the findings obtained in our study, E. coli O104 strains were isolated from raw meat samples and these food products may serve as potential vehicles for transmitting these pathogens to humans if the food products are consumed undercooked. Figure 1 indicates a 1% (w/v) agarose gel of the wzxO104 gene fragments amplified.
4. Discussions
It has been established that domestic and wildlife animals are the natural reservoirs of STEC and EHEC and the presence of these bacteria in the environment results through the uncontrolled release of faeces [15]. Therefore, these bacteria pathogens have the potential to contaminate food and water bodies if proper hygiene is not implemented. Bacterial foodborne zoonotic infections are the most common cause of human intestinal disease in many countries. This explains the need for enhanced research efforts and surveillance programs to enforceappropriate control measures by the food industry and also awareness to consumers [49]. Shiga toxin-producing E. coli are currently considered an important group of foodborne zoonotic pathogens due to the fact that they are frequently associated with diarrhoea, haemorrhagic colitis (HC) and the life threatening haemolytic uraemic syndrome (HUS) in humans in many countries worldwide [50]. Domestic animals especially pigs and cattle have been reported as the major reservoirs of STEC in South Africa [30, 31, 33] and other parts of the world [51]. There is currently no report describing the detection of non E. coli O157:H7 strains from food products in the North West Province of South Africa.
The objective of this study was to isolate E. coli O104 strains in meat samples collected from different supermarkets in the Mafikeng area and to identify these isolates using Gram staining, oxidase test, Triple Sugar Iron test, citrate utilization, Sorbitol fermentation tests, API 20E biochemical profiles and PCR analysis. In this study, E. coli O104 was detected and isolated from raw meat products that are sold in some supermarkets. The E. coli O104 strains were identified using both preliminary microbiology identification methods and a PCR assay. Most of the studies conducted on these species employed PCR assays only for their detection from samples [19]. Generally, there are two different approaches that are currently used to detect STEC in foods [52, 53, 54, 55, 56, 57]. Serogroup-independent techniques rely on the prevalence of genes and the characteristics of contaminating STEC strains [52, 54] while serogroup-dependent methods target a subset of E. coli serogroups that frequently implicated in human diseases and outbreaks and may be directed at E. coli O26, O45, O91, O103, O111, O121, O145 and O157 strains [53, 55, 56, 57]. Consequently, other E. coli serotypes such as O113:H21, O174:H21 and the newly emerging O104:H4 serotype that are less frequently associated with human infections, but can still cause cases of HUS and can contaminate food products will therefore be missed [58]. In addition most of the protocols designed to detection of Shiga toxin-producing Escherichia coli (STEC) in food and water sources [27, 28, 29, 30, 32, 59] typically focus on E. coli O157:H7 [27, 28, 29, 32, 59]. Against this background there is need to develop species specific assays to constantly and affectively monitor the occurrence of these non-O157 strains in food and water.
In France cattle was not a reservoir for the highly virulent E. coli O104:H4 strains [60]. However, other related E. coli O104 strains have been isolated from contaminated milk in the USA and sprouts in Germany [20]. EHEC strains are present in the gastrointestinal tract of domestic animals and during the removal of intestinal contents, faecal contamination or contact between the hide and carcass can facilitate the transmission of pathogenic E. coli strains to the meat [15, 61]. Moreover in most developing countries hygiene conditions are highly compromised [62] and therefore these increase the chances of contamination [16]. The implementation of routine pathogen surveillance strategies would great reduce human infections. This study reveals the presence of E. coli O104 strains in raw meat samples obtained from some supermarkets in the North West Province, South Africa. There is need to identify virulence determinants that would serve as definitive markers for determining the pathogenicity of the current strains.
5. Conclusion
In the present study E. coli O104 strains were successfully isolated from raw meat products and these isolates could have severe health complications on humans if thefood products arenot properly cooked before consumption. Given the complications posed by this pathogen in some European countries recently, coupled with the present baseline data it is suggested that a full scale study should be conducted to determine the occurrence of this organisms in a number of food products. An investigation of their virulence gene determinants and the genetic relationships of isolates from different sources will be of great epidemiological value.
Acknowledgement
We gratefully acknowledge Mr. B.J Morapedi for his assistance during the collection of samples and Mrs Huyser Rika for technical assistance during this study. This study was financially supported by Department of Biological Sciences, North West University and the North West University Postgraduate Merit Bursary.
References
| [1] | Harakeh, S., Yassine, H., Gharios, M., Barbour, E., Hajjar, S., El-Fadel, M., Toufeili, I. and Tannous, R., “Isolation, molecular characterization and antimicrobial resistance patterns of Salmonella and Escherichia coli isolates from meat-based fast food in Lebanon”. Sci Total Environ 134. 33-44. 2005. | ||
In article | CrossRef | ||
| [2] | Nettleman, M.D.,“Shiga toxin: E. coli O104:H4”. 2011. | ||
In article | |||
| [3] | Selander, R.K., Musser, J.M., Caugant, D.A., Gilmour, M.N., and Whittam, T.S. “Population genetics of pathogenic bacteria”. Microbial Path 3. 1-7. 1987. | ||
In article | CrossRef | ||
| [4] | Nataro, J.P. and Kaper, J.B., “Diarrhoeagenic Escherichia coli”.Clin Microbiol Rev11. 142-201. 1998. | ||
In article | |||
| [5] | Karmali, M. A., “Infection by verotoxin-producing Escherichia coli”. Clin Microbiol Rev 2. 15-38. 1989. | ||
In article | |||
| [6] | Wieler, L. H., Ilieff, A., Herbst, W., Bauer, C., Vieler, E., Bauerfeind, R., et al “Prevalence of enteropathogens in suckling and weaned piglets with diarrhoea in southern Germany”. J Vet Med B48. 151-159. 2001. | ||
In article | CrossRef | ||
| [7] | Frank, C., Faber, M.S., Askar, M., Bernard, H., Fruth, A., Gilsdorf, A., Hohle, M., Karch, H., Krause, G., Prager, R., Spode, A., Stark, K. and Werber, D., “HUS investigation team. Large and ongoing outbreak of haemolytic uraemic syndrome, Germany, May 2011”. Euro Surveill16(21).19878. 2011. | ||
In article | |||
| [8] | Bielaszewska, M., Mellmann, A., Zhang, W., Kock, R., Fruth, A., Bauwens, A., Peters, G. and Karch, H., “Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study”. Lancet Infect Dis 11. 671-676. 2011. | ||
In article | CrossRef | ||
| [9] | Page, A.V. and Liles, W.C., “Enterohaemorrhagic Escherichia coli infections and the Haemolytic-Uraemic Syndrome”. Med Clin North Am 97(4). 681-695. 2013. | ||
In article | CrossRef | ||
| [10] | Karmali, M.A., Mascarenhas,M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., Isaac-Renton, J., Clark, C., Rahn, K. and Kaper, J.B., “Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol 41. 4930-4940. 2003. | ||
In article | CrossRef | ||
| [11] | ] Franz, E. and van Bruggen, A.H., “Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain. Crit Rev Microbiol 34. 143-161. 2008. | ||
In article | CrossRef | ||
| [12] | Fremaux, B., Prigent-Combaret, C. and Vernozy-Rozand, C., “Long-term survival of Shiga toxin-producing Escherichia coli in cattle effluents and environment: an updated review”. Vet Microbiol 132 1-18. 2008. | ||
In article | CrossRef | ||
| [13] | Berger, C.N., Sodha, S.V., Shaw, R.K., Griffin, P.M., Pink, D., Hand, P. and Frankel, G., “Fresh fruit and vegetables as vehicles for the transmission of human pathogens”. Environ Microbiol 12. 2385-2397. 2010. | ||
In article | CrossRef | ||
| [14] | Bugarel, M., Beutin, L., Martin, A., Gill, A. and Fach, P., “Micro-array for the identification of Shiga toxin-producing Escherichia coli (STEC) seropathotypes associated with Haemorrhagic Colitis and Haemolytic Uremic Syndrome in humans”. Int J Food Microbiol 142. 318-329. 2010. | ||
In article | CrossRef | ||
| [15] | Capriole, A., Morabito, S., Brugereb, H. and Oswald, E., “Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission”. Vet Res 36. 289-311. 2005. | ||
In article | CrossRef | ||
| [16] | Mohammed, M.A.M., “Molecular characterization of diarrheagenic Escherichia coli isolated from meat products sold at Monsoura city, Egypt”. Food Cont 25. 159-164. 2012. | ||
In article | CrossRef | ||
| [17] | Rangel, J.M., Sparling, P.H., Crowe, C., Griffin, P.M. and Swerdlow, D.L, “Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002”. Emerg Infect Dis 11. 603-609. 2005. | ||
In article | CrossRef | ||
| [18] | Erickson, M.C. and Doyle, M.P., “Food as a vehicle for transmission of Shiga toxin- producing Escherichia coli”. Food Protect 70. 2426-2449. 2007. | ||
In article | |||
| [19] | Miko, A., Delannoy, S., Fach, P., Strockbine, N.A., Lindstedt, B.A., Mariani-Kurkdjian, P., Reetz, J. and Beutin, L., “Genotypes and virulence characteristics of Shiga toxin-producing Escherichia coli O104 strains from different origins and sources”. Int J Med Microbiol 303(8). 410-421. 2013 | ||
In article | CrossRef | ||
| [20] | Scharlach, M., Diercke, M., Dreesman, J., Jahn, N., Krieck, M., Beyrer, K., Claußen, K., Pulz, M. and Floride, R., “Epidemiological analysis of a cluster within the outbreak of Shiga toxin-producing Escherichia coli serotype O104:H4 in Northern Germany, 2011”. Int J Hyg Environ Health 216(3). 341-345. 2013. | ||
In article | CrossRef | ||
| [21] | Soon, J.M., Seaman, P. and Baines, R.N., “Escherichia coliO104:H4 outbreak from sprouted seeds”. Int J Hyg Environ Health 216(3). 346-354. 2013. | ||
In article | CrossRef | ||
| [22] | Cramer, J.P., “Enterohaemorrhagic Escherichia coli (EHEC): Haemorrhagic Colitis and Haemolytic Uraemic Syndrome (HUS). Emerg Infect Dis 213-227. 2014. | ||
In article | |||
| [23] | Rhoades, J.R., Duffy, G. and Koutsoumanis, K., “Prevalence and concentration of verocytotoxigenic Escherichia coli, Salmonella enterica and Listeria monocytogenes in the beef production chain: a review”. Food Microbiol 26. 357-376. 2009. | ||
In article | CrossRef | ||
| [24] | Karmali, M.A., Gannon, V. and Sargeant, J.M., “Verocytotoxin-producing Escherichia coli (VTEC)”. Vet Microbiol 140. 360-370. 2010. | ||
In article | CrossRef | ||
| [25] | Browning, N.G., Botha, J.R., Sacho, H. and Moore, P.J., “Escherichiacoli O157:H7 haemorrhagic colitis. Report of the first South African case”. South Afr J Surg 28(1). 28-29. 1990. | ||
In article | |||
| [26] | Müller, E.E., Ehlers, M.M. and Grabow, W.O.K., “The occurrence of E. coli O157:H7 in Southern African water sources intended for direct and indirect human consumption”. Water Res 35. 3085-3088. 2001. | ||
In article | CrossRef | ||
| [27] | Müller, E.E., Taylor, M.B., Grabow, W.O.K. and Ehlers, M.M., “Isolation and characterisation of Escherichia coli O157:H7 and shiga toxin-converting bacteriophages from strains of human, bovine and porcine origin”. Water Sup 2(3). 29-38. 2002. | ||
In article | |||
| [28] | Müller, E.E., Grabow, W.O.K. and Ehlers, M,M., “Immunomagnetic separation of Escherichiacoli O157:H7 from environmental and wastewater in South Africa”. Water SA 29(4). 427-432. 2003. | ||
In article | |||
| [29] | Müller, E.E. and Ehlers, M.M., “Biolog identification of non-sorbitol fermenting bacteria isolated on E. coli O157 selective CT-SMAC agar”. Water SA 31(2). 247-251. 2005. | ||
In article | |||
| [30] | Ateba, C.N., Mbewe, M. and Bezuidenhout, C.C., “The Prevalence of Escherichia coli O157 strains in cattle, pigs and humans in the North-West Province, South Africa”. SAJS 104. 78. 2008. | ||
In article | |||
| [31] | Ateba, C.N. and Bezuidenhout, C.C., “Characterization of Escherichia coli O157 strains from humans, cattle and pigs in the North-WestProvince, South Africa”. Int J Food Microbiol, 128. 181-188. 2008. | ||
In article | CrossRef | ||
| [32] | Momba, M.N.B., Abongo, B.O. and Mwambakana, J.N., “Prevalence of enterohaemorrhagic Escherichia coli O157:H7 in drinking water and its predicted impact on diarrhoeic HIV/AIDS patients in the Amathole District, Eastern Cape Province, South Africa”. Water SA 34 (3). 365-372.2008. | ||
In article | |||
| [33] | Ateba, C.N. and Mbewe, M.,“Detection of Escherichia coli O157:H7 virulence genes in isolates from beef, pork, water, human and animal species in the North-West Province, South Africa: public health implications”. Res Microbiol162. 240-248. 2011. | ||
In article | CrossRef | ||
| [34] | Ateba, C.N. and Mbewe, M.,“Determination of the genetic similarities of fingerprints from Escherichia coli O157:H7 isolated from different sources in the North West Province, South Africa using ISR, BOXAIR and REP-PCR analysis”. Microbiol Res168. 438-446. 2013. | ||
In article | CrossRef | ||
| [35] | European Centre for Disease Prevention and Control and European Food Safety Authority, 2011. Shiga toxin/verotoxin-producing Escherichia coli in humans, food and animals in the EU/EEA, with special reference to the German outbreak strain STEC O104. Stockholm: ECDC. Available from: | ||
In article | |||
| [36] | http://ecdc.europa.eu/en/publications/Publications/1106_TER_EColi_joint_EFSA.pdf. | ||
In article | |||
| [37] | Askar, M., Faber, M.S., Frank, C., Bernard, H., Gilsdorf, A., Fruth, A., Prager, R., Hohle, M., Suess, T., Wadl, M., Krause, G., Stark, K. and Werber, D., “Update onthe ongoing outbreak of haemolytic uraemic syndrome due to Shiga toxinproducing Escherichia coli (STEC) serotype O104, Germany, May 2011”. Euro Surveill 16(22). 19883. 2011. | ||
In article | CrossRef | ||
| [38] | Brzuszkiewicz, E., Thürmer, A., Schuldes, J., Leimbach, A., Liesegang, H., Meyer, F.D., Boelter, J., Petersen, H., Gottschalk, G. and Daniel, R.,“Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: Entero-Aggregative- Haemorrhagic Escherichia coli (EAHEC)”. Arch Microbiol 193. 883-91. 2011. | ||
In article | CrossRef | ||
| [39] | Frank, C., Werber, D., Cramer, JP et al.“Epidermic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany- preliminary report”. N Engl J Med. 2011. | ||
In article | |||
| [40] | Kett, D.H., Quartin, A.A., Mangino, J.E., Zervos, M.J., Ramirez, J.A. and IMPACT – HAP study groups. Escherichia coli O104:H4 South – West France. 2011. | ||
In article | |||
| [41] | Mellmann, A., Harmsen, D., Cummings, C.A., Zentz, E.B., Leopold, S.R., Rico, A., Prior, K., Szczepanowski, R., Ji, Y., Zhang, W., McLaughlin, S.F., Henkhaus, J.K., Leopold, B., Bielaszewska, M., Prager, R., Brzoska, P.M., Moore, R.L., Guenther, S., Rothberg, J.M. and Karch, H.,“Prospective genomic characterization of the German enterohemorrhagic Escherichiacoli O104:H4 outbreak by rapid next generation sequencing technology”. PLoS One 6(7).e22751.2011. | ||
In article | |||
| [42] | Borgatta, B., Kmet-Lunaˇcekb, N. and Relloc,J., E. coli O104:H4 outbreak and haemolytic uraemic syndrome”. Med Inten36(8). 576-583. 2012. | ||
In article | |||
| [43] | Goodridge, L.D., LeJeune, J.T. and Beutin, L., “What was the source of the 2011outbreak of Escherichia coli in Germany and France?”.Case Studies Food Safety Authenticity 43-53. 2012. | ||
In article | |||
| [44] | Cruishank, R., Duguid, J.P., Marmain, B.P. and Swain, R.H., Medical Microbiology, 12th Edition, New York. Longman Group Limited 2: 34. 1975. | ||
In article | |||
| [45] | Forbes, A.B. and Weissfeld, A.S., Bailey and Scott’s Diagnostic Microbiology, 10th Edition. Mosby, St. Louis, MO.1998. | ||
In article | |||
| [46] | Kiiyukia, C., Venkateswaran, K., Navarro, I.M., Nakano, H., Kawakami, H. and Hashimoto, H., “Seasonal distribution of Vibrio parahaemolyticus serotypes along the oyster beds in Hiroshima coast” J Fac Appl Biol Sci, Hiroshima Univ. 28. 49-61. 1989. | ||
In article | |||
| [47] | Tunung, R., Chai, L.C., Usha, M.R., Lee, H.Y., Fatimah, A.B., Farinazleen, A.B. and Son, R., “Characterization of Salmonella enterica isolated from street food and clinical samples in Malaysia”. ASIAN Food J 14. 161-173.2007. | ||
In article | CrossRef | ||
| [48] | Bugarel, M., Beutin, L., Martin, A., Gill, A. and Fach, P.,“Micro-array for the identification of Shiga toxin-producing Escherichia coli (STEC) seropathotypes associated with Hemorrhagic Colitis and Hemolytic Uremic Syndrome in humans”. Int J Food Microbiol 142. 318-329. 2010. | ||
In article | |||
| [49] | Sambrook, J., Fritsch, E.F. and Maniatis, T.’ Molecular Cloning, A Laboratory Manual. 2nd Ed. New York: Cold Spring Harbour Laboratory Press. 1989. | ||
In article | CrossRef | ||
| [50] | Newell, D.G., Koopmans, M., Verhoef, L., Duizer, E., Aidara-Kane, A., Sprong, H., Opsteegh, M., Langelaar, M., Threfall, J., Scheutz,F., der Giessen, J.V. and Kruse, H., “Foodborne diseases - the challenges of 20 years ago still persist while new ones continue toemerge”. IntJ Food Microbiol 139. 3-15. 2010. | ||
In article | CrossRef | ||
| [51] | Hussein, H.S., “Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products”. J Ani Sci 85. 63-72. 2007. | ||
In article | CrossRef | ||
| [52] | Karch, H., Tarr, P.I. and Bielaszewska, M., 2005. Enterohaemorrhagic Escherichia coliin human medicine. Int J Med Microbiol 295, 405-418. | ||
In article | CrossRef | ||
| [53] | Fach, P., Perelle, S., Dilasser, F. and Grout, J., « Comparison between a PCR-ELISA test and the Vero cell assay for detecting Shiga toxin-producing Escherichia coli in dairy products and characterization of virulence traits of the isolated strains”. J Appl Microbiol 90. 809-818. 2001. | ||
In article | CrossRef | ||
| [54] | Auvray, F., Lecureuil, C., Tache, J., Leclerc, V., Deperrois, V. and Lombard, B., “Detection, isolation and characterization of Shiga toxin-producing Escherichia coli in retailminced beef using PCR-based techniques, immunoassays and colony hybridization”. Lett ApplMicrobiol 45. 646-651. 2007. | ||
In article | CrossRef | ||
| [55] | Beutin, L., Miko, A., Krause, G., Pries, K., Haby, S., Steege, K. and Albrecht, N., “Identification of human-pathogenic strains of Shiga toxin-producing Escherichiacoli from food by a combination of serotyping and molecular typing of Shiga toxin genes”. Appl Environ Microbiol 73. 4769-4775. 2007. | ||
In article | CrossRef | ||
| [56] | Madic, J., Lecureuil, C., Dilasser, F., Derzelle, S., Jamet, E., Fach, P. and Auvray, F., «Screening of food raw materials for the presence of Shiga toxin-producing Escherichia coli O91:H21. Lett Appl Microbiol 48. 447-451. 2009. | ||
In article | CrossRef | ||
| [57] | Fratamico, P.M., Bagi, L.K., Cray, W.C., Narang, N., Yan, X., Medina, M. and Liu, Y., “Detection by multiplex real-time polymerase chain reaction assays and isolation of Shiga toxin-producing Escherichia coli serogroups O26, O45, O103, O111, O121, and O145 in ground beef”. Foodborne Path Dis 8. 601-607. 2011. | ||
In article | CrossRef | ||
| [58] | Madic, J., Vingadassalon, N., de Garam, C.P., Marault, M., Scheutz, F., Brugere, H., Jamet, E. and Auvray, F., “Detection of Shiga toxin-producing Escherichia coli serotypes O26: H11, O103:H2, O111:H8, O145:H28, and O157:H7 in raw-milk cheeses by using multiplex real-time PCR”. Appl Environ Microbiol 77. 2035-2041. 2011. | ||
In article | CrossRef | ||
| [59] | Scheutz, F., Teel, L.D., Beutin, L., Piérard, D., Buvens, G., Karch, H., Mellmann, A., Caprioli, A., Tozzoli, R., Morabito, S., Strockbine, N.A., Melton-Celsa, A.R., Sanchez, M., Persson, S. and O'Brien, A.D.,“Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature”. J Clin Microbiol50. 2951-63. 2012. | ||
In article | |||
| [60] | Maruzumi, M., Morita, M., Matsouka, Y., Uekawa, A., Nakamura, T. and Fugi, K., « Mass food poisoning caused by beef offalcontaminated by Escherichia coli O157”. Jap J Infect Dis 58. 397. 2005. | ||
In article | CrossRef | ||
| [61] | Auvray, F., Dilasser, F., Bibbal, D., Kérourédan, M., Oswald, E. and Brugère H., “French cattle is not a reservoir of the highly virulent enteroaggregative Shiga toxin-producing Escherichia coli of serotype O104:H4”. Vet Microbiol 158. 443-445. 2012. | ||
In article | CrossRef | ||
| [62] | Elder, R.O., Keen, J.E., Siragusa, G.R., Barkocy-Gallagher, G.A., Koohmaraie, M. and Laegried, W.W., “Correlation of enterohaemorrhagic Escherichia coli O157 prevalence in faeces, hides and carcasses of beef cattle during processing”. Proc Nat Acad Sci 97. 2999-3003. 2000. | ||
In article | |||
| [63] | Islam, M.S., Mahmud, Z.H., Gope, P.S., Zaman, R.U., Hossain, Z., Islam, M.S., Mondal, D., Sharker, M.A.Y., Islam, K., Jahan, H., Bhuiya, A., Endtz, H.P., Cravioto, A., Curtis, V., Tour, O., and Cairncross, S., “Hygiene intervention reduces contamination of weaning food in Bangladesh”. Trop Med Int Health 18(3). 250-258. 2013. | ||
In article | |||
OPEN ACCESS
PEER-REVIEWED



PowerPoint Slide
Larger image(png format)
View current table in a new window



In article
CiteULike
Delicious

