Article Versions
Export Article
Cite this article
  • Normal Style
  • MLA Style
  • APA Style
  • Chicago Style
Research Article
Open Access Peer-reviewed

Polycyclic Aromatic Hydrocarbons (PAHs) Metabolism by White Rot Fungi Agaricomycetes sp AGAT and Its Microcosm Study

Archana Pandey, Akshaya Gupte
International Journal of Environmental Bioremediation & Biodegradation. 2018, 6(2), 36-56. DOI: 10.12691/ijebb-6-2-1
Received July 07, 2018; Revised August 26, 2018; Accepted September 11, 2018

Abstract

Hydrocarbon pollution is a perennial problem not only in India but throughout the globe. A plethora of microorganisms have been reported to be efficient degraders of these recalcitrant pollutants. In the present study the Basidiomycetous a fungal isolate Agaricomycetes sp. AGAT was isolated from wood bark collected from Anand, Gujarat India. The isolate was screened for production of ligninolytic enzyme by primary and secondary screening. The isolate Agaricomycetes sp. AGAT is also able to degrade the polycyclic aromatic hydrocarbons (PAHs) present in the contaminated soil. The basidiomycetous fungal Agaricomycetes sp. AGAT was able to grow on 100 ppm Pyrene, Phenanthrene, Fluorene and Fluoranthene as a sole source of carbon in minimal medium. Maximum degradation of 78.53%, 85.05%, 20.5% and 70.49% of Phenanthrene, Pyrene, Fluoranthene and Fluorene respectively. The depletion in the residual PAHs in the culture medium was determined by HPLC. By GC-MS analysis metabolites were identified as 1-hydroxypyrene and phthalic acid from Pyrene, 9H- Fluoren-9-ol from Fluorene, Fluorene, 4-[1,2-dihydroxethyl] from Fluoranthene and 9,10-dihydro-9,10-dihydroxyphenanthrene from Phenanthrene. Further effect of surfactants, mediator were also studied. Phytotoxicity study of degraded metabolite was also studied.

1. Introduction

Basidiomycetes group are regarded as most interesting group of fungi with their ability to grow under detrimental environment condition constantly acting as natural degraders of lignocellulose 1. They are further classified into brown rot fungi and white rot fungi according to the way they degrade wood. Brown rot fungi have ability to degrade wood polysaccharides while white rot fungi have ability to decompose all wood polymers including lignin. White rot fungi are known for actively degrading lignin because of presence of extracellular enzyme complex containing lignin peroxidase (LiP, E.C. 1.11.1.14), manganese peroxidase (MnP, E.C. 1.11.1.13) and laccase (Lac, E.C.1.10.3.2). These enzymes are involved in oxidation of lignin present in wood and in oxidation of xenobiotic compounds including synthetic dyes and polycyclic aromatic hydrocarbons (PAHs).

Contamination of environment by aromatic compounds has become one of the global problem. Polycyclic aromatic hydrocarbons (PAHs) contamination is serious and increasing problem for human and ecosystem because of spill in soil, water and other natural resources. Polycyclic aromatic hydrocarbons (PAHs) are a group of organic compound having two or more fused benzene ring which have been identified as persistent organic pollutants and are of great concern due to the characteristics of toxicity, mutagenicity and carcinogenicity. The US Environmental Protection Agency (US EPA) has listed 16 PAHs as priority pollutants 2, 3. PAHs are formed due to incomplete pyrolysis of organic materials such as petroleum, coal and wood.

Various potential techniques are being developed now-a-days to overcome these problems. Microbiological process of degradation of organic pollutants is considered as a promising method for environmental problem. Use of microbial resources for remediation of PAH contaminant has been important ‘green solution’ 4, 5, 6. Bioremediation is the technique using microbes (bacteria, fungi and algae) which degrade or transform and mineralize contaminants to carbon di oxide and water. Bioremediation is simple process that is economical, versatile, ecofriendly and efficient as compared to chemical technique that produce toxic intermediate and have lower bioavailability for contaminants. The extracellular ligninolytic enzymes secreted by white rot fungi oxidize PAHs via a non-specific, radical-based reaction with corresponding quinones 7. Catalysis reaction by laccase depends on the monoelectronic oxidation transforming the substrate to reactive radicals with the help of mediator 8. Use of various mediators (ABTS, HBT and Phenol) for enhancement of PAH degradation have being reported by 9, 10, 11. PAHs bioavailability can be enhanced by addition of surfactants which increase its surface tension and increase its solubilization through formation of micelles in solution. This phenomena is observed at its critical micellar condition (CMC) 12.

The main objective of the present work was to study degradation of Pyrene, Phenanthrene, Fluoranthene and Fluorene by white rot fungi Agaricomycetes sp AGAT. Attempts were made for enhancing the degradation of PAHs by addition of surfactants and mediators to the medium. The potential isolate Agaricomycetes sp AGAT was explored for its interaction with indigenous microflora present in the soil through microcosm study. Degraded metabolites were analyzed using HPLC and GC-MS analysis.

2. Materials and Method

2.1. Microorganisms and Culture Conditions

Agaricomycetes sp AGAT (Genbank accession no. KT153994) was grown on 2% Malt extract agar (MEA). MEA contained (g/l) Malt Extract 30.0, Peptone 5.0, and Agar 25.0 (pH: 5.4) at 30°C.

2.2. Chemicals

ABTS (2, 2-Azino-bis (3-ethylbenzthiozoline-6-sulphonic acid), Phenol and HBT (1-hydroxybenzotriazole) was purchased from Sigma Aldrich (Sigma St. Louis, MO, USA). Malt Extract Agar (MEA), glucose, sodium acetate, KH2PO4, H3BO3, NaNoO4, Alk (SO4)2, yeast extract, sodium dedecyl sulphate (SDS), sodium sulphate, thiamine were purchased from Hi-Media Labs (Mumbai, India). Ammonium tartrate, copper (II) sulphate pentahydrate, manganese (II) sulphate monohydrate, magnesium sulphate heptahydrate, calcium chloride dihydrate, zinc sulfate were procured from S D Fine chemicals (Mumbai, India). Tween 80, Triton X-100, Ethyl acetate, Acetone, Acetonitrile, HCl and HPLC grade water were purchased from Merck (Mumbai, India).

Polycyclic aromatic hydrocarbon (PAHs) Pyrene, Phenanthrene, Fluorene and Fluoranthene were procured from Sigma Aldrich (Sigma St. Louis, MO, USA).

2.3. Enzyme Assays

Laccase (E.C.1.1.03.2) activity was determined by measuring the oxidation of 2, 2’-azino-bis 3-ethylbenzothiazoline-6-sulphoric acid (ABTS) as increase in absorbance for 3 minutes was measured spectrophotometrically at 420nm (ε = 36000cm-1 M-1) 13. The reaction mixture contained 100μl of 50 mM ABTS and 800 μl of 20 mM Sodium Acetate buffer (pH 4.5) and 100 μl of appropriately diluted enzyme extract. One unit of enzyme activity was defined as the amount of enzyme that oxidized 1 µM of corresponding substrate per min.

2.4. Isolation, Screening and Identification of Isolated Fungal Strain

Various mushroom samples, decayed wood and barks of trees were collected from the nearby regions of Vadodara (22°19’18.64” N 73°09’19.19” E) and Anand (22°33’08.87” N 72°55’38.68” E) Districts, Gujarat, India. Samples collected were screened for the presence of ligninolytic enzymes. Surface sterilization of collected samples was performed by suspending in 0.01% (v/v) mercuric chloride solution for 2-3 minutes followed by washing. The samples were placed on 2% (w/v) malt extract agar (MEA) plates containing streptomycin (25µg/ml) and the plates were further incubated at 28°C for 8-10 days. Isolated cultures were repeatedly sub cultured to obtain a pure culture. Microscopic studies were performed to study the characteristic of white rot fungi. Further samples were screened for the phenol oxidase activity. The presence of laccase enzyme (primary screening) was studied using various chromogenic substrates like ortho-dianisidine; guaiacol and gallic acid at a concentration of 0.01% (w/v) supplemented in 2% (w/v) malt extract agar plates. The actively grown culture (agar plugs) were placed on the plates and incubated at 28°C for 10 days. Fungal isolate showing positive Bevandamm’s reactions were further explored for the quantitative detection of ligninolytic enzymes. Cultures were maintained on MEA plates at 30°C and stored at 4°C.

Quantitative detection (secondary screening) of ligninolytic enzyme was performed using 5.0 gm of wheat bran as a solid substrate with Asther’s medium as a moistening agent under solid state fermentation.

The molecular identification of the new isolate AGAT was done by using ITS4 (TCCTCCGCTTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) gene sequencing by Agarkhar Research Institute (ARI) Pune, India.

2.5. PAHs Degradation

Degradation studies were conducted in 250ml Erlenmeyer flasks containing 100 ml of degradation medium prepared according to Tien & Kirk 14 containing (g/l) glucose 10, ammonium Tartrate 0.2, sodium acetate 3.28, thiamine 2, KH2PO4 2; MgSO4.7 H2O, 0.53; CaCl2, 0.1; CuSO4, 0.001, MnSO4, 0.005; H3BO3, 0.001; NaMoO4. 2H2O, 0.0001; ZnSO4. 7H2O, 0.0001; AlK (SO4)2. 12H2O, 0.0001; and yeast extract 0.5. The pH of the medium was adjusted to 5.0 with 2N HCl. Flasks were sterilized at 121°C for 20 min. Thiamine was separately filter sterilized and added thereafter. All the flasks were inoculated with fungal agar disc of 9 mm diameter from the edge of the actively growing culture. All the flasks were incubated at 28°C at 100 rpm for 6 days. Stock solution of PAHs were prepared in acetone, filter sterilized with help of 0.2 µm filter and added to 6 day old culture at a final concentration of 100 ppm. All the flasks were re-incubated at 28°C at 100 rpm for 25 days.


2.5.1. Effect of Surfactants on PAHs Degradation

Surfactants plays an important role in degradation of PAHs in order to study the effect of surfactant the degradation medium was seeded with surfactants like SDS, Triton X-100 and Tween 80 at a concentration of 0.1,1 and 2mM. Control flask was without surfactant.


2.5.2. Effect of mediator on PAHs degradation

Mediator plays an important role in degradation of PAHs in order to study the effect of mediator the degradation medium was seeded with mediator like ABTS, Phenol and HBT at a concentration of 0.1,1 and 2mM. Control flask was without mediator.

2.6. Extraction of Residual PAHs

The entire content of the flask (100ml) were extracted for determination of residual PAHs.

After addition of PAHs to six day old culture extraction was done on 5th, 10th, 15th, 20th and 25th day of incubation. The mycelia was filtered using Whatman filter paper No1. The liquid was extracted in double volume of ethyl acetate, kept at 30°C at 150 rpm for 30 mins. The mixture was separated using separating funnel. The organic phase was collected and saved.

The extract obtained was dried using anhydrous sodium sulphate to remove aqueous phase.

2.7. Calculations for PAHs Degradation Rate

Degradation rate of PAHs was calculated by subtracting the amount of PAH extracted from the abiotic control from the other samples. The rate of degradation was calculated as:

PAH degradation rate (%) = Abiotic control extraction (100%) - Sample extraction

Sample extraction means filtrate obtained.

2.8. Microcosm Study

Microcosm preparation was planned in four different sets of soil model systems were prepared as:

• (Set A)-Sterile soil containing PAH which served as abiotic control

• (Set B)-Sterile soil supplemented with PAH (100ppm) was inoculated by Agaricomycetes sp AGAT to determine the PAH degradation efficiency by Agaricomycetes sp AGAT in absence of indigenous organisms

• (Set C)-Non sterile Soil with native or indigenous organisms and PAH, to evaluate the intrinsic ability of soil to degrade PAH

• (Set D)-Non sterile soil supplemented with PAH and inoculated with Agaricomycetes sp AGAT to check the degradation rate by Agaricomycetes sp AGAT in presence of indigenous flora.

2.9. Analytical Procedures
2.9.1. Determination of residual PAHs:

The residual PAHs were analyzed by reverse-phase HPLC (Shimadzu, Japan) equipped with Nuclosil 100-5 Column (C-18 PAH Column, 250mm X 4.6mm) series 200 pump. Detection was done using D2 detector set at 254 nm. Dried samples were re-extracted in 1 ml of mobile phase (Acetonitrile: Water, 70:30), filtered through 0.2µM filter and 20µl was injected to HPLC Column.


2.9.2. Detection of Metabolites

The residual metabolite was extracted from the sample with equal volume of ethyl acetate. Further 2ml of sample was transferred to GC vial for GC-MS analysis carried out by using Shimadzu Gas Chromatograph Mass Spectrophotometer GC-MS (Shimadzu). The total sample injected was 2µl.


2.9.3. Phytotoxicity Analysis

The method of testing of Phytotoxicity of PAHs and its metabolites was performed according to Kalme et al., 15. The test was carried out for standard and the extracted metabolites on the seeds of Triticum aestivum, common Indian agricultural crops. Ten seeds were supplied daily with 10ml of standard and extracted metabolites dissolved in water for 7-10 days in small pots, maintaining light and temperature (30°C) in a controlled environment. Toxicity effect was measured in terms of percent germination, lengths of root and shoot of the plant after 7-10 days.


2.9.4. Data Analysis

The data in subsequent sections represent arithmetic mean values of three experimental repetitions (each one was made in duplicate).

3. Results

3.1. Isolation and Primary Screening

In the present study out of 15 isolates only 8 isolates were potential to produce ligninolytic enzyme by plate assay method. Dark brown zone surrounding the growth of mycelial disc on MEA plate containing o-dianisidine and gallic acid. Reddish brown colour zone was observed with plate containing guaiacol at concentration of 0.01% w/v (Figure 1). This is a characteristic of phenol oxidase which indicates of positive bevandamm’s reaction for laccase activity. Further the isolate were classified as poor, moderate, good and excellent producer of laccase (Table 1).

Secondary screening of laccase was done using wheat bran as solid substrate and Asther’s medium as moistening agent under solid state fermentation (SSF) (Figure 2). Maximum production of 1.65 X 105 U/g of dry substrate was obtained on 10th day of incubation for wheat bran. Hence, on the basis of primary and secondary screening isolate AGAT was selected and explored for PAHs degradation.

3.2. Identification of the Fungal Isolate
3.2.1. Macroscopic Characteristics

Isolate AGAT fruiting body was found to be grown on bark of wood of mulberry tree with fleshy white mat like growth. Strain grew well on MEA covering the entire plate in 8-10 days incubated at 28°C.


3.2.2. Microscopic Characteristics

Microscopic examination of fruiting body revealed the presence of Basidiospores and gleopleros hyphae and binding hyphae as shown in Fig 3.sp Spore observed were size of around 12.56 X 7.75 µm. The molecular identification of the new isolate AGAT was confirmed by isolation of genomic DNA followed by amplification of ITS region of rDNA using universal fungal primers ITS4 and ITS5 (Agharkar Research Institute, Pune). Similarity of the DNA sequence in Genbank Database was found to be same with Agaricomycetes sp. with 99% similarity. The isolate was identified as Agaricomycetes sp. AGAT with Genbank Accession No KT153994 (Figure 4).

3.3. Growth of Fungal Culture Agaricomycetes sp AGAT on PAHs

The isolate Agaricomycetes sp. AGAT was grown on MEA plate containing 100 ppm of each PAH (Benzo (a) Anthracene, Fluorene, Pyrene, Acenaphthene, Anthracene and Phenanthrene).the isolate Agaricomycetes sp. AGAT was able to grow and utilize PAH as a sole source of carbon and energy as shown in Figure 5. Table 2 shows the growth in terms of zone of proliferation of isolate Agaricomycetes sp. AGAT on 8th day of incubation.

3.4. Degradation of PAHs by Agaricomycetes sp AGAT

The isolate Agaricomycetes sp. AGAT was grown in degradation medium (Minimal Salt medium) by spiking with different PAHs as sole source of carbon and energy. Degradation study using LMW PAH like Phenanthrene and Fluorene while HMW PAH like Pyrene and Fluoranthene was done. Agaricomycetes sp. AGAT was able to degrade 30.5% Phenanthrene in 20 days with 1250 U/ml of enzyme activity. Degradation of PAHs was dome more efficiently in presence of co-substrate such as glucose (Figure 6).

With addition of glucose as co-substrate in degradation medium the degradation of Phenanthrene increased to 78.53% with 3394.16U/ml on 20th day of incubation. Amongst the various co-substrates glucose was found to be best. Therefore, glucose was used in our further studies for the degradation of PAHs (Figure 7).

The degradation profile of various PAHs were studied with respect to laccase activity, incubation period and % degradation. In the present study 100 ppm of different PAHs were used for degradation study by fungal culture Agaricomycetes sp AGAT. Pyrene showed maximum degradation of 85.05% on 15th day of incubation with 2650.2 U/ml of enzyme activity and Fluoranthene reported 20.5% degradation on 25th day of incubation with 3580.2 U/ml enzyme activity (Figure 8 - Figure 11).

No further significant PAHs degradation was observed. The growth of fungus in liquid medium with PAHs can be observed by comparing it with control flask (Figure 12).

3.5. Effect of Different Surfactants on Degradation of PAHs

All the surfactants (SDS, Tween 80 and Triton X-100) were incorporated in medium. At concentration of 1mM were found to enhance the degradation of PAH as compared to control and other two concentration i.e. 0.1mM and 2 mM. When the surfactants used at different concentration then considerable difference in degradation was observed (Figure 13 - Figure 15).

Whereas Figure 13 shows a significant increase in degradation of Fluoranthene from 20.35% to 88.09%. Further increase in concentration of Tween 80 reduced the degradation as high concentration of surfactant may affect the growth of fungi in medium.

Similarly SDS was also found to be effective in increasing PAHs degradation as Tween 80. Maximum degradation of around 99% of Pyrene, Fluoranthene, Phenanthrene and Fluorene at concentration of 0.1mM, 1mM and 2mM was obtained.

3.6. Effect of Different Mediator Compounds on Degradation of PAHs

In the present study 3 mediator used were ABTS, HBT and Phenol at concentration of 0.1mM, 1mM and 2mM. Amongst all HBT was found to be best and powerful mediator in PAH degradation. Around 99.1% of Pyrene removal was observed on 15th day of incubation. HBT showed 95.25%, 94.74% and 75.25% removal of Phenanthrene, Fluorene and Fluoranthene on 20th and 25th day of incubation respectively at 2mM concentration. Even at low concentration of 0.1mM HBT showed effective enhancement in PAH degradation (Fig 16).ABTS showed 98% elimination of Pyrene and Phenanthrene at concentration of 2mM. Around 90.21% degradation of Fluorene and 86.98% degradation of Fluoranthene were obtained at 2mM concentration of ABTS (Figure 17). Phenol also used mediator showed almost 90% removal of all PAHs in system at concentration of 2mM (Figure 18).

3.7. Microcosm Study to Explore the Bioremediation Potential of Agaricomycetes sp AGAT

Microcosm study of PAHs such as Phenanthrene, Fluoranthene, Fluorene and Pyrene at concentration of 100 ppm using different sets of experiments were studied. The study shows the abiotic loss of Phenanthrene i.e. set A without microorganisms was about 25% i.e. control set (Set A). In set B 76.63% Phenanthrene degradation was observed by Agaricomycetes sp AGAT without the presence of indigenous flora. Presence of microbes in soil showed 45.50% (set c) degradation while set D showed maximum degradation of 96.66% with presence of both micro-flora and isolate AGAT (Figure 19). Present study showed that the maximum degradation in presence of Fluorene (93.88%) was achieved in set B i.e. having only presence of isolate Agaricomycetes sp AGAT as compared to set D which showed 46.20% degradation in presence of both indigenous flora along with isolate Agaricomycetes sp AGAT as shown in Figure 20. Pyrene and Fluoranthene also showed maximum degradation of 90.25% and 35.74% by Agaricomycetes sp AGAT present in sterile soil i.e. Set D. (Figure 21- Figure 22).

3.8. Detection of PAH Degradation Metabolites

For detection of degraded metabolite GC-MS analysis was performed. GC-MS analysis showed one peak as compared to control sample which was identified as 1-hydroxypyrene and phthalic acid with 218.5 m/z and 166.3m/z ratio respectively (Figure 23). Proposed pathway is shown in Figure 24.

GC-MS spectra of Phenanthrene showed presence of one peak as compared to control as shown in Figure 25. Peak corresponds to formation of 9,10-dihydroxy Phenanthrene it’s an intermediate compound formed due to ring cleavage of cytochrome P-450 and epoxide hydrolase enzyme. Proposed pathway for degradation of Phenanthrene is shown as in Figure 26.

GC-MS analysis of Fluorene was Fluoren-9-ol as intermediate product after degradation on 20th day of incubation (Figure 27 - Figure 28). Fluorene 4- [1,2-dihydroethyl] is the intermediate detected by mass spectra of Fluoranthene (Figure 29 - Figure 30).

3.9. Phytotoxicity Study of Degraded Metabolite

The results of phytotoxicity studies using PAHs and its degraded metabolite on Triticum aestivum are shown in Table 3. Length of plumule and root length (in cms) of germinated seeds were recorded after 10 days. Maximum shoot length observed in degradation metabolite of Pyrene (21 cms) Figure 31.

% germination of seeds was affected after addition of PAH at concentration of 100 ppm to pot as compared to degraded metabolite as shown in Table 3. It is observed that Fluorene is most toxic for seed germination as compared to other PAHs.

4. Discussion

By plate assay method isolate were screened for ligninolytic enzyme production using o-dianisidine, guaiacol and gallic acid. Positive Bevandamm’s reaction observed for laccase activity. Chhaya and Gupte 16 reported the similar results with litter dwelling fungi for screening of laccase producers using ABTS and guaiacol as a substrate. Gao et al., 17, Patel et al., 18 and Agrawal et al., 19 reported the similar results for the screening of presence of laccase enzyme in the fungi by plate assay. Primary screening method is a very rapid for detection of the presence of the laccase enzyme by comparing the intensity of color and time required for development of colour due to oxidation of chromogens.

Solid state fermentation is one of the best process which have been used for ligninolytic enzyme production using agro-industrial residues. As agro-industrial residues are produced world-wide in abundance as a waste/ by product of crop cultivation and food processing industry. Secondary screening of laccase production was carried out using wheat bran as a solid substrate and Asther medium as a moistening agent under solid state fermentation. The Asther’s medium 20 was used as a moistening agent to maintain the moisture level of the substrates. Maximum laccase production of 1.65 X 105 U/g of dry substrate for wheat bran was reported on 10th day of incubation. Vares et al., 21 and Gupte et al., 22 reported higher laccase production with Phlebia radiata and Pleurotus ostreatus respectively under SSF using wheat straw as substrate. Kapoor et al., 23 also reported maximum laccase production with Lentinus edodes from peanut meal supplemented wheat straw. On the basis of primary and secondary screening the isolate Agaricomycetes sp. AGAT was selected for further studies as it was considered as an excellent producer of laccase.

PAHs are considered to be environmental pollutants which having the ability to affect plants, animals and humans. PAH are mainly degraded by biological transformations thus the use of microbes represents the potential route for the removal of PAH from the environment. White rot fungi are the choice of organisms used widely in bioremediation. They are known to actively degrade wide range of recalcitrant and xenobiotic compounds. It has been assumed by many researchers that the degradation of these compounds is catalyzed by the enzymatic machinery of these fungi 24, 25, 26. Fungi like Pleurotus eryngii 27, Pleurotus pulmonaris F043 25, Scopulariopsis brevicaulis 28, Pycnoporus sanguineus H1 2 and Phanerochaete chrysosporium 29 has been used for PAHs degradation.

The isolate Agaricomycetes sp AGAT showed degradation in degradation medium. The % degradation was enhanced in presence of co-substrate glucose present in medium. Mao and Guan 28 reported enhanced degradation of PAH by Scopulariopsis brevicaulis. using glucose as co-substrate. Hwang et al., 30 and Tekere et al., 31 also reported using other co-substrates enhanced the degradation. It has been reported by Wang et al., 32; Swamy and Ramsay 33; that the degradation of organic pollutants is faster when glucose is used as a co-substrate for growth.100% removal of Fluorene within 23 days was reported by Hadibarata and Kristanti 27 at a concentration of 10 ppm by fungal isolate Pleurotus eryngii F032 while 100% Fluoranthene was eliminated in 30 days at 10ppm concentration by Pleurotus pulmonarius F043 25. Mao and Guan 28 using Scopulariopsis brevicaulis reported removal of Pyrene (64.3%), Fluoranthene (61.9%) and Phenanthrene (60%) after 30 days. The decline in PAHs removal probably occurs in nitrogen limiting conditions. This can attributed as ligninolytic enzymes are also produced in nitrogen-limiting condition which decrease the PAHs available in the system. The present study shows the involvement of laccase in the degradation process.

Bioavailability for PAH degradation was enhanced by addition of surfactant to the medium. Surfactants have been known to increase surface area of the PAHs and the subsequent flux in an aqueous medium 34. The solubility of the PAHs studied were as Phenanthrene 1.3mg/l; Fluoranthene 0.26 mg/l; Pyrene 0.14mg/l and Fluorene 1.992 mg/l 35. The rate of degradation depends on the mass transfer rate of PAHs from solid phase to water phase 36. Surfactants become intermediate between immiscible phases because of their hydrophobic and hydrophilic moieties. By addition of surfactants it increases the concentration of hydrophobic compounds in water phase by solubilization or emulsification. Solubilization occurs only above a specific threshold concentration, critical micellar concentration (CMC) after which surfactants molecules will aggregate to micelles. 72% degradation could be achieved by Hadibarata and Tachibana 37 with Tween 80 as surfactants after 30 days of incubation. Tween 80 enhance both uptake and release of compounds from the cells through modification of cell membrane permeability. Zhao et al., 38 found that Tween 80 is best for the degradation of Phenanthrene. Rate of degradation increased from 68.8% to 87.4% in the presence of AOT with Tween 80 within 10 days by Pleurotus ostreatus D1 11. Higher concentration of SDS may inhibit the growth of fungi. It may be attributed due to change in physico-chemical interactions between fungus and surfactants or limited bioavailability of micellar PAH due to low exit rates from the micelles 39. Degradation of PAHs has been investigated by using Triton X-100 and SDS with P.chrysogenum, M.racemosus, L.theobromae 40..

In the present study in vivo system is used where whole of fungal culture is used for degradation of PAHs. The PAHs selected for the present study is LMW-PAH and HMW -PAH with two or more benzene rings. The reaction catalyzed by laccase depends on monoelectric oxidation which transforms substrates to corresponding reactive radicals. The small molecule which act as single electron donor and activator of enzymes known as mediators enhances the rate of oxidation of the enzyme. The synthetic mediators like ABTS and HBT are mainly used in degradation studies. In our study three mediator used were ABTS, HBT and phenol at varying concentration of 0.1mM, 1mM and 2mM. ABTS when used as a mediator in a system the rate of degradation of Pyrene increased to 92% by Pyconoporus sanguineus H1 2. HBT has been used widely as mediator because of its high redox potential and its ability to stimulate PAHs oxidation by laccase 41. Higher concentration resulted in complete removal of PAH due to production of coupling products with oxidized mediators in a nonstoichiometric production of the quinone 42.

Bioaugmentation technique has been proposed as a strategy for enhancement of the bioremediation of contaminated soils. For in-situ bioremediation of the contaminated sites, addition of microorganisms has been a valuable tool in order to increase the rate and extent of biodegradation of organic pollutants. Various physico-chemical parameters affect the efficiency of organisms as compared to native microbial population present in contaminated sites. The use of organism depends on survival and performance in natural ecosystem. Therefore, to ensure the organism need to be studied for its survival and degradation efficiency in soil and also in the presence of the ingenious microbial populations 43, 44. Microcosm study provides an insight towards the competition between culture and indigenous microflora present in the environment. Bioaugmentation by Paracoccus sp increased Phenanthrene degradation as reported by Teng et al., 45. Jain and Bajpai 46; Singh and Ward 47 reported that in natural environment various processes have been studied in order to understand the role of microorganisms and microbial communities in bioremediation. The degradation of Fluorene, Fluoranthene and Pyrene in soil was 0, 6.2% and 7.5% respectively within 10 days 8. Degradation of PAHs Fluorene, Fluoranthene, Phenanthrene and Pyrene was increased from 98 to 100%, 73 to 98%, 99 to 100% and 26 to 94% by inoculation of P.velutina to soil sample which shows that the degradation rate enhanced together by P.velutina together with indigenous microbes 48. Anthracophyllum discolor degraded Phenanthrene (62%), Fluoranthene (54%) and Pyrene (60%) from soil sample after 60 days of incubation 49.

For detection of degraded metabolite GC-MS analysis were performed of all PAHs. 1-hydroxypyrene and phthalic acid with 218.5 m/z and 166.3 m/z ratio respectively were reported from degradation of Pyrene. Bezalel et al., 50 reported that initially pyrene was metabolized at the 4, 5 bond (K region) which forms an epoxide, which was hydrated to form pyrene trans-4, 5-dihydrodiol using Pleurotus ostreatus. Sack et al., 51 reported 1-pyrenol as degraded metabolite using wood decaying fungi.

It has been reported by various researchers that the ring metabolite 2, 2’-diphenic acid is from Phenanthrene via Phenanthrene trans9,10-dihydrol or Phenanthrene 9,10-quinone. This dead end product formed 2, 2’-diphenic acid is produced due to activity of ligninolytic enzymes from various white rot fungi 26, 50, 51, 52.

Further decarboxylation reaction leads to formation of dead end product phthalic acid which leads to central metabolism pathway. The GC-MS of all four PAHs compound showed the presence of phthalic acid as an intermediate compound. Phthalic acid formation is one of the ring fission products formed after degradation of PAHs by white rot fungi, further derivatization of phthalic acid to carbon-di-oxide and highly polar metabolites takes place 53.

The toxicity of the degraded product can be defined as phytotoxicity assay. The PAH and its degraded metabolite were used for phytotoxicity study using Triticum asetivum seeds. The rate of germination can be used as an indicator for pollutant contamination because this process is very sensitive to various kinds of pollutants 54. The toxic effects of PAHs depends on various factors. Chemical structure and chemical properties of the pollutants are main reason for affecting PAH toxicity. Phytotoxicity study of various PAHs has been reported by Somtrakoon and Chouychai 55 on economic crops.

In conclusion, large number of isolate were screened for ligninolytic enzyme production by plate assay method. The isolate showing positive Bevandamm’s reactions by oxidation of phenolic compounds were screened for secondary screening. The isolate AGAT was identified as Agaricomycetes sp AGAT by ITS4 & ITS5 sequencing and further explored for PAHs degradation study. In present study a varied rate of degradation of various PAHs (Pyrene, Fluorene, Fluoranthene and Phenanthrene) were observed using Agaricomycetes sp AGAT. Rate of degradation depends upon their molecular weight and structure. There is correlation observed between ligninolytic enzyme and PAHs degradation. In-situ bioremediation techniques i.e. microcosm study has been performed which showed the importance of the indigenous flora present by increasing the degradation of PAH. Phytotoxicity study was performed on Triticum asetivum to check the effect of degraded metabolites obtained after degradation. GC-MS analysis was performed for identification of metabolites formed. A proposed pathways for PAHs degradation has been given depending upon the intermediate obtained in our study.

Acknowledgements

The authors are grateful to Department of Biotechnology (BT/PR7567/BCE/8/1005/2013), Ministry Of Science and Technology Govt. of India, New Delhi for their financial support and Sophisticated Instrumentation Centre for Applied Research and Testing (SICART) for providing instrumentation facility for the successful completion of this work.

Conflict of Interest

The authors declare that they have no conflict of interest.

References

[1]  Lee H, Jang Y, Choi YS, Kim MJ, Lee J, Lee H, Hong JH, Lee YM, Kim GH, Kim JJ (2014). Biotechnological procedures to select white rot fungi for the degradation of PAHs. J. Microbiol. Methods 97: 56-62.
In article      View Article  PubMed 
 
[2]  Zhang S, Ning Y, Zhang X, Zhao Y, Yang X, Wu K, Yang S, La G, Sun X, Li X (2015). Contrasting characteristics of anthracene and pyrene degradation by wood rot fungus Pycnoporus sanguineus H1. Int. Biodeterior. Biodegradation 105: 228-232.
In article      View Article 
 
[3]  Wu YR, Luo ZH, Vrijmoed LLP (2010). Biodegradation of anthracene and benz[a]anthracene by two Fusarium solani strains isolated from mangrove sediments. Bioresour Technol 101: 9666-9672.
In article      View Article  PubMed 
 
[4]  Gogoi BK, Dutta NN, Goswami P, Krishna MTR (2003) A case study of bioremediation of petroleum-hydrocarbon contaminated soil at a crude oil spill site. Adv Environ Res 7: 767-782.
In article      View Article 
 
[5]  Townsend GT, Prince RC, Suflita JM (2004) Anaerobic biodegradation of alicyclic constituents of gasoline and natural gas condensate by bacteria from an anoxic aquifer. FEMS Microbiol Ecol 49: 129-135.
In article      View Article  PubMed 
 
[6]  Pham V H T, Chaudhary DK, Jeong SW, Kim J (2018).Oil-degrading properties of a psychrotolerant bacterial strain Rhodococcus sp. Y2-2, in liquid and soil media. World J Microbiol Biotechnol 34(33) 1-11.
In article      
 
[7]  Bamforth SM and Singleton I. (2005). Bioremediation of polycyclic aromatic hydrocarbons. J. Chem. Technol. Biotechnol. 80: 723-736.
In article      View Article 
 
[8]  Li XZ, Lin XG, Yin R, Wu YC, Chu HY, Zeng J, Yang T (2010). Optimization of laccase-mediated benzo[a]pyrene oxidation and the biomedical application n aged polycyclic aromatic hydrocarbons-contaminated soil. J Health Sci 56: 534-540.
In article      View Article 
 
[9]  Covino S, Svobodova K, Kresinova Z, Petruccioli M, Federici F, Annibale AD, Cvancarova M, Cajthaml T (2010). Invivo and in-vitro polycyclic aromatic hydrocarbons degradation by Lentinus (Panus) tigrinus CBS 577.79. Bioresour Technol 101: 3004-3012.
In article      View Article  PubMed 
 
[10]  Han Mj, Choi HT, Song HG (2004). Degradation of Phenanthrene by Trametes versicolor and its laccase. J Microbiol42(2): 94-98.
In article       PubMed 
 
[11]  Pozdnyakova N, Rodakiewicz j, NowakTurkovskaya OV, Haber J. (2006). Oxidative degradation of polyaromatic hydrocarbons catalyzed by blue laccase form Pleurotus ostreatus D1 in the presence of synthetic mediators. Enzyme Microb. Technol. 39: 1242-1249.
In article      View Article 
 
[12]  Wilson SC and Jones KC. (1993). Bioremediation of soil contaminated with polynuclear aromatic hydrocarbons (PAHs): A review. Environ Pollut 81(3): 229-49.
In article      View Article 
 
[13]  Johnsy G and Kaviyarasan V. (2014). Effect of physico-chemical parameters on ligninolytic enzyme production of an indigenous isolate of Neolentinus kanffmanii under submerged condition. World J Pharm Sci 2321-3310.
In article      
 
[14]  Tien M and Kirk TK. (1988). Lignin peroxidase of Phanerochaete chrysosporiumMethods Enzymol l161:238-249.
In article      
 
[15]  Kalme SD, Jadhav SU, Parshetti GK, Govindwar SP (2010). Biodegradation of Green HE4B: Co-substrate effect, biotransformation enzymes and metabolite toxicity analysis. Indian J Microbiol. 50: 156-154.
In article      View Article  PubMed 
 
[16]  Chhaya U and Gupte A (2013). Effect of different cultivation conditions and inducers on the production of Laccase by the litter-dwelling fungal isolate Fusariumin carnatum LD-3 under solid state fermentation, Ann Microbiol 63(1): 215-223.
In article      View Article 
 
[17]  Gao H, Wang Y, Zhang W, Wang W, Mu Z. (2011). Isolation, identification and application in lignin degradation of ascomycetes GHJ-4. Afr. J. Biotechnol.. 10: 4166-4174.
In article      
 
[18]  Patel H, Gupte A, Gupte S. (2009). Biodegradation of Fluoranthene by basidiomycetes fungal isolate Pleurotus ostreatus HP-1 Appl Biochem Biotechnol 157: 367-376.
In article      View Article  PubMed 
 
[19]  Agrawal N, Verma P, Singh RS, Shahi SK (2017). Ligninolytic enzyme production by white rot fungi Podoscypha elegans strain FTG4. International Journal of Current Microbiology and Applied Sciences 6(5): 2757-2764.
In article      View Article 
 
[20]  Asther M, Lesage L, Drapron R, Corrieu G, Odie RE. (1988). Phospholipid and fatty acid enhancement of Phanerochaete chrysoporium INA - 12 in relation to ligninase production. Appl Microbiol Biotechnol. 27: 393-398.
In article      View Article 
 
[21]  Vares T, Kalsi M, Hatakka A. (1995). Lignin peroxidases, manganese peroxidases, and other ligninolytic enzymes produced by Phlebia radiata during solid-state fermentation of wheat straw. Appl Environ Microbiol 61: 351-3520.
In article      
 
[22]  Gupte A, Gupte S and Patel H (2007). Ligninolytic enzyme production under solid state fermentation by white-rot fungi. Journal of Scientific and Industrial Research. 66: 611-614.
In article      
 
[23]  Kapoor S, Khanna PK, Katyal P. (2009). Effect of supplementation of wheat straw on growth and lignocellulolytic enzyme potential of Lentinus edodes. World Journal of Agricultural Sciences 5: 328-331.
In article      
 
[24]  Hadibarata T and Tachibana S (2010). Characterization of Phenanthrene degradation by strain Polyporus sp. S133. J Environ Sci 22(1): 142-149.
In article      View Article 
 
[25]  Wirasnita R and Hadibarata T (2016). Potential of the White-Rot Fungus Pleurotus pulmonarius F043 for Degradation and Transformation of Fluoranthene. Pedosphere 26(1): 49-54.
In article      View Article 
 
[26]  Bezalel L, Hadar Y, Cerniglia C (1997). Enzymatic Mechanism Involved in Phenanthrene Degradation by the White Rot Fungus Pleurotus ostreatus. Appl Environ Microbiol 63(7): 2495-2501.
In article       PubMed  PubMed 
 
[27]  Hadibarata T and Kristanti R.A (2014). Potential of a White-rot fungus Pleurotus eryngii F032 for degradation and transformation of fluorene. Fungal Biol. 118: 222-227.
In article      View Article  PubMed 
 
[28]  Mao J and Guan W (2016). Fungal degradation of polycyclic aromatic hydrocarbon (PAHs) by Scopulariopsis brevicaulis and its application in bioremediation of PAH-contaminated soil. ACTA Agricultuare Scandinavica Section B-Soil and Plant Science 66(5): 399-405.
In article      
 
[29]  Hammel KE, Gai WZ, Green B, Moen MA (1922). Oxidative Degradation of Phenanthrene by the Ligninolytic Fungus Phanerochaete chrysosporium. Appl Environ Microbiol 58(6): 1832-1838.
In article      
 
[30]  Hwang HM, Hu X, Zhao X (2007). Enhanced bioremediation of polycyclic aromatic hydrocarbons by environmentally friendly techniques. J Environ Sci Health 25: 313-352.
In article      View Article  PubMed 
 
[31]  Tekere M, Read JS, Mattiasson B (2005). Polycyclic aromatic hydrocarbon biodegradation in extracellular fluids and static batch cultures of selected sub-tropical white rot fungi. J Biotechnol 115: 367-377.
In article      View Article  PubMed 
 
[32]  Wang N, Hill G, Peng J (2002). The role of glucose in developing enhanced biological phosphorous removal. Environmental Engineering and Policy 3: 45-54.
In article      View Article 
 
[33]  Swamy J and Ramsay JA (1999). Effects of glucose and NH4+ concentration on sequential dye decolorization by Trametes versicolor. Enzyme Microb Technol 25: 278-284.
In article      View Article 
 
[34]  Reddy PG, Singh HD, Roy Pk, Baruah JN (1982). Predominant role of hydrocarbon solubilization in the microbial uptake of hydrocarbons. Biotechnol. Bioeng. 24: 1241-1269.
In article      View Article  PubMed 
 
[35]  Cerniglia CE. (1992).Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation 3(2): 51-368.
In article      
 
[36]  Tiehm A. (1994). Degradation of polycyclic aromatic hydrocarbons in the presence of synthetic surfactants. Appl Environ Microbiol 60: 258-263.
In article       PubMed  PubMed 
 
[37]  Hadibarata T, Tachibana S, Itoh K.(2009). Biodegradation of chrysene, an aromatic hydrocarbon by Polyporus sp. S133 in liquid medium. J Hazard Mater164: 911-917.
In article      View Article  PubMed 
 
[38]  Zhao H, Wu Q, Wang L, Zhao X, Gao H. (2009). Degradation of Phenanthrene by bacterial strain isolated from soil in refinery fields in Shanghai China. J Hazard Mater 164: 863-869.
In article      View Article  PubMed 
 
[39]  Garon D, Krivobok S, Wouessidjewe D,Seigle-Murandi F. (2002). Influence of surfactants on solubilization and fungal degradation of fluorine. Chemosphere 47: 303-309.
In article      View Article 
 
[40]  Balaji V, Arulazhagan P, Ebnezer P. (2014). Enzymatic bioremediation of polyaromatic hydrocarbons by fungal consortia enriched from petroleum contaminated soil and oil seeds. J Env Biol 35: 521-529.
In article       PubMed 
 
[41]  Majcherczyk A, Johannes C, Huttermann A (1988). Oxidation of polycyclic aromatic hydrocarbon (PAH) by laccase of Trametes versicolor. Enzyme Microb. Technol. 22: 335-341.
In article      View Article 
 
[42]  Johannes C and Majcherczyk (2000). Natural Mediators in the oxidation of Polycyclic Aromatic Hydrocarbons by Laccase Mediator System. Appl Environ Microbiol 66(2): 524-528.
In article      View Article  PubMed 
 
[43]  Kastner M, Breuer-Jammali M, Mahro B (1998). Impact of inoculation protocols, salinity and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival of PAH-degrading bacteria introduced into soil. Appl Environ Microbiol 64: 359-362.
In article       PubMed  PubMed 
 
[44]  Patel V, Patel J, Madamwar D (2013). Biodegradation of Phenanthrene in bio augmented microcosm by consortium Asp developed from coastal sediment of Alang-Sosiya ship breaking yard. Marine Poll Bull 74: 199-207.
In article      View Article  PubMed 
 
[45]  Teng Y, Luo Y, Sun M, Liu Z, Li Z, Christie P (2010). Effect of bioaugmentation by Paracoccus sp strain HPD-2 on the soil microbial community and removal of polycyclic aromatic hydrocarbons from an aged contaminated soil. Bioresour Technol 101: 3437-3443.
In article      View Article  PubMed 
 
[46]  Jain PK and Bajpaiv (2012). Biotechnology of Bioremediation- An review. International Journal of Environmental Science 3: 535-549.
In article      
 
[47]  Singh A and Ward OP (2004). Biotechnology and Bioremediation - an overview. Biodegradation and Bioremediation. Springer 1-17.
In article      View Article 
 
[48]  Winquist E, Bjorklof K, Schultz E, Rasanen M, Salonen K, Anasonye F, Cajthaml T, Steffen K, Jorgensen K, Tuomela M. (2016).Bioremediation of PAH-contaminated soil with fungi- From laboratory to field scale. Int. Biodeterior. Biodegradation 86: 238-247.
In article      View Article 
 
[49]  Acevedo F, Pizzul L, Castillo MD, Cuevas R, Diez MC (2011). Degradation of polycyclic aromatic hydrocarbons by the Chilean white-rot fungus Anthracophyllum discolor. J. Hazard. Mater. 185: 212-219.
In article      View Article  PubMed 
 
[50]  Bezalel L,Hadar Y,Fu PP, Freeman JP, Cerniglia C (1996). Metabolism of Phenanthrene by white rot fungus Pleurotus ostreatus .Applied And Environmental Microbiology 62(7): 2547-2553.
In article       PubMed  PubMed 
 
[51]  Sack U, Heinze TM, and Deck J, et al. (1997). Comparison of Phenanthrene and pyrene degradation by different wood-decaying fungi. Appl Environ Microbiol 63: 3919-3925.
In article       PubMed  PubMed 
 
[52]  Vila J, Lopez Z, Sabate J, Minguillon C, Solanas AM, Grifoll M (2001). Identification of a novel Metabolite in the Degradation of Pyrene by Mycobacterium sp. Strain AP1: Actions of the Isolate on Two-and Three-Ring Polycyclic Aromatic Hydrocarbons. Appl Environ Microbiol 67(12): 5497-5505.
In article      View Article  PubMed 
 
[53]  Kottermann MJJ, Rietberg HJ, Hage A, Field JA. (1997). Polycyclic aromatic hydrocarbon oxidation by the white-rot fungus Bjerkandera sp. Strain BOS55 in the presence of non-ionic surfactants. Biotechnol. Bioeng. 57: 220-227.
In article      View Article 
 
[54]  Calvelo, Pereira R, Monterroso C, Macias F. (2010). Phytotoxicity of Hexachlorocyclohexane: Effect on Germination and Early Growth of Different Plant Species, Chemosphere 79: 326-333.
In article      View Article  PubMed 
 
[55]  Somtrakoon K and Chouychai (2013). Phytotoxicity of single and combined polycyclic aromatic hydrocarbons toward economic crops. Russ. J. Plant Physiol. 60(1): 139-148.
In article      View Article 
 

Published with license by Science and Education Publishing, Copyright © 2018 Archana Pandey and Akshaya Gupte

Creative CommonsThis work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Cite this article:

Normal Style
Archana Pandey, Akshaya Gupte. Polycyclic Aromatic Hydrocarbons (PAHs) Metabolism by White Rot Fungi Agaricomycetes sp AGAT and Its Microcosm Study. International Journal of Environmental Bioremediation & Biodegradation. Vol. 6, No. 2, 2018, pp 36-56. http://pubs.sciepub.com/ijebb/6/2/1
MLA Style
Pandey, Archana, and Akshaya Gupte. "Polycyclic Aromatic Hydrocarbons (PAHs) Metabolism by White Rot Fungi Agaricomycetes sp AGAT and Its Microcosm Study." International Journal of Environmental Bioremediation & Biodegradation 6.2 (2018): 36-56.
APA Style
Pandey, A. , & Gupte, A. (2018). Polycyclic Aromatic Hydrocarbons (PAHs) Metabolism by White Rot Fungi Agaricomycetes sp AGAT and Its Microcosm Study. International Journal of Environmental Bioremediation & Biodegradation, 6(2), 36-56.
Chicago Style
Pandey, Archana, and Akshaya Gupte. "Polycyclic Aromatic Hydrocarbons (PAHs) Metabolism by White Rot Fungi Agaricomycetes sp AGAT and Its Microcosm Study." International Journal of Environmental Bioremediation & Biodegradation 6, no. 2 (2018): 36-56.
Share
  • Figure 1. (a) Fruiting Body of AGAT. (b) Growth pattern of AGAT on 2%MEA, (c) - (e) Plate assay for Laccase on MEA plate containing different chromogenic substrates viz. orth-dianisidine, Guaiacol and Gallic acid
  • Figure 3. (a) Clamp connection observed in mycelium (b) Spores of mycelium (c) generative hyphae with clamp connection (d) Spores of mycelium (e) Gloeopleros hyphae (f) Basidiospores observed in fruiting body (g) Binding hyphae
  • Figure 5. Fungal culture grown on different PAH used as sole source of carbon: (a). Control (b) Benzo(a) Fluoranthene (c) Fluorene (d) Pyrene (e) Acenaphthene(f) Anthracene (g) Phenanthrene
  • Figure 12. Growth of Agaricomycetes sp. on different PAHs. (100ppm): (a) Control (b) Pyrene (c ) Fluoranthene (d) Phenanthrene (e) Fluorene (f) Acenaphthene (g) Anthracene
  • Figure 13. Degradation of PAHs in the presence of different concentrations of Tween 80 on 15th day of Pyrene, 20th day of Phenanthrene and Fluorene and 25th day of Fluoranthene
  • Figure 14. Degradation of PAHs in the presence of different concentrations of SDS on 15th day of Pyrene, 20th day of Phenanthrene and Fluorene and 25th day of Fluoranthene
  • Figure 15. Degradation of PAHs in the presence of different concentrations of Triton X-100 on 15th day of Pyrene, 20th day of Phenanthrene and Fluorene and 25th day of Fluoranthene
  • Table 1. Response of different fungal isolates on MEA plates containing different chromogenic substrates
  • Table 2. Growth of Fungal Culture on MEA Plate with different PAHs (100 ppm) on 8th day of incubation period
  • Table 3. Phytotoxicity study of different PAHs and its degraded metabolite on lengthe of plumule of Triticum asetivum seeds
[1]  Lee H, Jang Y, Choi YS, Kim MJ, Lee J, Lee H, Hong JH, Lee YM, Kim GH, Kim JJ (2014). Biotechnological procedures to select white rot fungi for the degradation of PAHs. J. Microbiol. Methods 97: 56-62.
In article      View Article  PubMed 
 
[2]  Zhang S, Ning Y, Zhang X, Zhao Y, Yang X, Wu K, Yang S, La G, Sun X, Li X (2015). Contrasting characteristics of anthracene and pyrene degradation by wood rot fungus Pycnoporus sanguineus H1. Int. Biodeterior. Biodegradation 105: 228-232.
In article      View Article 
 
[3]  Wu YR, Luo ZH, Vrijmoed LLP (2010). Biodegradation of anthracene and benz[a]anthracene by two Fusarium solani strains isolated from mangrove sediments. Bioresour Technol 101: 9666-9672.
In article      View Article  PubMed 
 
[4]  Gogoi BK, Dutta NN, Goswami P, Krishna MTR (2003) A case study of bioremediation of petroleum-hydrocarbon contaminated soil at a crude oil spill site. Adv Environ Res 7: 767-782.
In article      View Article 
 
[5]  Townsend GT, Prince RC, Suflita JM (2004) Anaerobic biodegradation of alicyclic constituents of gasoline and natural gas condensate by bacteria from an anoxic aquifer. FEMS Microbiol Ecol 49: 129-135.
In article      View Article  PubMed 
 
[6]  Pham V H T, Chaudhary DK, Jeong SW, Kim J (2018).Oil-degrading properties of a psychrotolerant bacterial strain Rhodococcus sp. Y2-2, in liquid and soil media. World J Microbiol Biotechnol 34(33) 1-11.
In article      
 
[7]  Bamforth SM and Singleton I. (2005). Bioremediation of polycyclic aromatic hydrocarbons. J. Chem. Technol. Biotechnol. 80: 723-736.
In article      View Article 
 
[8]  Li XZ, Lin XG, Yin R, Wu YC, Chu HY, Zeng J, Yang T (2010). Optimization of laccase-mediated benzo[a]pyrene oxidation and the biomedical application n aged polycyclic aromatic hydrocarbons-contaminated soil. J Health Sci 56: 534-540.
In article      View Article 
 
[9]  Covino S, Svobodova K, Kresinova Z, Petruccioli M, Federici F, Annibale AD, Cvancarova M, Cajthaml T (2010). Invivo and in-vitro polycyclic aromatic hydrocarbons degradation by Lentinus (Panus) tigrinus CBS 577.79. Bioresour Technol 101: 3004-3012.
In article      View Article  PubMed 
 
[10]  Han Mj, Choi HT, Song HG (2004). Degradation of Phenanthrene by Trametes versicolor and its laccase. J Microbiol42(2): 94-98.
In article       PubMed 
 
[11]  Pozdnyakova N, Rodakiewicz j, NowakTurkovskaya OV, Haber J. (2006). Oxidative degradation of polyaromatic hydrocarbons catalyzed by blue laccase form Pleurotus ostreatus D1 in the presence of synthetic mediators. Enzyme Microb. Technol. 39: 1242-1249.
In article      View Article 
 
[12]  Wilson SC and Jones KC. (1993). Bioremediation of soil contaminated with polynuclear aromatic hydrocarbons (PAHs): A review. Environ Pollut 81(3): 229-49.
In article      View Article 
 
[13]  Johnsy G and Kaviyarasan V. (2014). Effect of physico-chemical parameters on ligninolytic enzyme production of an indigenous isolate of Neolentinus kanffmanii under submerged condition. World J Pharm Sci 2321-3310.
In article      
 
[14]  Tien M and Kirk TK. (1988). Lignin peroxidase of Phanerochaete chrysosporiumMethods Enzymol l161:238-249.
In article      
 
[15]  Kalme SD, Jadhav SU, Parshetti GK, Govindwar SP (2010). Biodegradation of Green HE4B: Co-substrate effect, biotransformation enzymes and metabolite toxicity analysis. Indian J Microbiol. 50: 156-154.
In article      View Article  PubMed 
 
[16]  Chhaya U and Gupte A (2013). Effect of different cultivation conditions and inducers on the production of Laccase by the litter-dwelling fungal isolate Fusariumin carnatum LD-3 under solid state fermentation, Ann Microbiol 63(1): 215-223.
In article      View Article 
 
[17]  Gao H, Wang Y, Zhang W, Wang W, Mu Z. (2011). Isolation, identification and application in lignin degradation of ascomycetes GHJ-4. Afr. J. Biotechnol.. 10: 4166-4174.
In article      
 
[18]  Patel H, Gupte A, Gupte S. (2009). Biodegradation of Fluoranthene by basidiomycetes fungal isolate Pleurotus ostreatus HP-1 Appl Biochem Biotechnol 157: 367-376.
In article      View Article  PubMed 
 
[19]  Agrawal N, Verma P, Singh RS, Shahi SK (2017). Ligninolytic enzyme production by white rot fungi Podoscypha elegans strain FTG4. International Journal of Current Microbiology and Applied Sciences 6(5): 2757-2764.
In article      View Article 
 
[20]  Asther M, Lesage L, Drapron R, Corrieu G, Odie RE. (1988). Phospholipid and fatty acid enhancement of Phanerochaete chrysoporium INA - 12 in relation to ligninase production. Appl Microbiol Biotechnol. 27: 393-398.
In article      View Article 
 
[21]  Vares T, Kalsi M, Hatakka A. (1995). Lignin peroxidases, manganese peroxidases, and other ligninolytic enzymes produced by Phlebia radiata during solid-state fermentation of wheat straw. Appl Environ Microbiol 61: 351-3520.
In article      
 
[22]  Gupte A, Gupte S and Patel H (2007). Ligninolytic enzyme production under solid state fermentation by white-rot fungi. Journal of Scientific and Industrial Research. 66: 611-614.
In article      
 
[23]  Kapoor S, Khanna PK, Katyal P. (2009). Effect of supplementation of wheat straw on growth and lignocellulolytic enzyme potential of Lentinus edodes. World Journal of Agricultural Sciences 5: 328-331.
In article      
 
[24]  Hadibarata T and Tachibana S (2010). Characterization of Phenanthrene degradation by strain Polyporus sp. S133. J Environ Sci 22(1): 142-149.
In article      View Article 
 
[25]  Wirasnita R and Hadibarata T (2016). Potential of the White-Rot Fungus Pleurotus pulmonarius F043 for Degradation and Transformation of Fluoranthene. Pedosphere 26(1): 49-54.
In article      View Article 
 
[26]  Bezalel L, Hadar Y, Cerniglia C (1997). Enzymatic Mechanism Involved in Phenanthrene Degradation by the White Rot Fungus Pleurotus ostreatus. Appl Environ Microbiol 63(7): 2495-2501.
In article       PubMed  PubMed 
 
[27]  Hadibarata T and Kristanti R.A (2014). Potential of a White-rot fungus Pleurotus eryngii F032 for degradation and transformation of fluorene. Fungal Biol. 118: 222-227.
In article      View Article  PubMed 
 
[28]  Mao J and Guan W (2016). Fungal degradation of polycyclic aromatic hydrocarbon (PAHs) by Scopulariopsis brevicaulis and its application in bioremediation of PAH-contaminated soil. ACTA Agricultuare Scandinavica Section B-Soil and Plant Science 66(5): 399-405.
In article      
 
[29]  Hammel KE, Gai WZ, Green B, Moen MA (1922). Oxidative Degradation of Phenanthrene by the Ligninolytic Fungus Phanerochaete chrysosporium. Appl Environ Microbiol 58(6): 1832-1838.
In article      
 
[30]  Hwang HM, Hu X, Zhao X (2007). Enhanced bioremediation of polycyclic aromatic hydrocarbons by environmentally friendly techniques. J Environ Sci Health 25: 313-352.
In article      View Article  PubMed 
 
[31]  Tekere M, Read JS, Mattiasson B (2005). Polycyclic aromatic hydrocarbon biodegradation in extracellular fluids and static batch cultures of selected sub-tropical white rot fungi. J Biotechnol 115: 367-377.
In article      View Article  PubMed 
 
[32]  Wang N, Hill G, Peng J (2002). The role of glucose in developing enhanced biological phosphorous removal. Environmental Engineering and Policy 3: 45-54.
In article      View Article 
 
[33]  Swamy J and Ramsay JA (1999). Effects of glucose and NH4+ concentration on sequential dye decolorization by Trametes versicolor. Enzyme Microb Technol 25: 278-284.
In article      View Article 
 
[34]  Reddy PG, Singh HD, Roy Pk, Baruah JN (1982). Predominant role of hydrocarbon solubilization in the microbial uptake of hydrocarbons. Biotechnol. Bioeng. 24: 1241-1269.
In article      View Article  PubMed 
 
[35]  Cerniglia CE. (1992).Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation 3(2): 51-368.
In article      
 
[36]  Tiehm A. (1994). Degradation of polycyclic aromatic hydrocarbons in the presence of synthetic surfactants. Appl Environ Microbiol 60: 258-263.
In article       PubMed  PubMed 
 
[37]  Hadibarata T, Tachibana S, Itoh K.(2009). Biodegradation of chrysene, an aromatic hydrocarbon by Polyporus sp. S133 in liquid medium. J Hazard Mater164: 911-917.
In article      View Article  PubMed 
 
[38]  Zhao H, Wu Q, Wang L, Zhao X, Gao H. (2009). Degradation of Phenanthrene by bacterial strain isolated from soil in refinery fields in Shanghai China. J Hazard Mater 164: 863-869.
In article      View Article  PubMed 
 
[39]  Garon D, Krivobok S, Wouessidjewe D,Seigle-Murandi F. (2002). Influence of surfactants on solubilization and fungal degradation of fluorine. Chemosphere 47: 303-309.
In article      View Article 
 
[40]  Balaji V, Arulazhagan P, Ebnezer P. (2014). Enzymatic bioremediation of polyaromatic hydrocarbons by fungal consortia enriched from petroleum contaminated soil and oil seeds. J Env Biol 35: 521-529.
In article       PubMed 
 
[41]  Majcherczyk A, Johannes C, Huttermann A (1988). Oxidation of polycyclic aromatic hydrocarbon (PAH) by laccase of Trametes versicolor. Enzyme Microb. Technol. 22: 335-341.
In article      View Article 
 
[42]  Johannes C and Majcherczyk (2000). Natural Mediators in the oxidation of Polycyclic Aromatic Hydrocarbons by Laccase Mediator System. Appl Environ Microbiol 66(2): 524-528.
In article      View Article  PubMed 
 
[43]  Kastner M, Breuer-Jammali M, Mahro B (1998). Impact of inoculation protocols, salinity and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival of PAH-degrading bacteria introduced into soil. Appl Environ Microbiol 64: 359-362.
In article       PubMed  PubMed 
 
[44]  Patel V, Patel J, Madamwar D (2013). Biodegradation of Phenanthrene in bio augmented microcosm by consortium Asp developed from coastal sediment of Alang-Sosiya ship breaking yard. Marine Poll Bull 74: 199-207.
In article      View Article  PubMed 
 
[45]  Teng Y, Luo Y, Sun M, Liu Z, Li Z, Christie P (2010). Effect of bioaugmentation by Paracoccus sp strain HPD-2 on the soil microbial community and removal of polycyclic aromatic hydrocarbons from an aged contaminated soil. Bioresour Technol 101: 3437-3443.
In article      View Article  PubMed 
 
[46]  Jain PK and Bajpaiv (2012). Biotechnology of Bioremediation- An review. International Journal of Environmental Science 3: 535-549.
In article      
 
[47]  Singh A and Ward OP (2004). Biotechnology and Bioremediation - an overview. Biodegradation and Bioremediation. Springer 1-17.
In article      View Article 
 
[48]  Winquist E, Bjorklof K, Schultz E, Rasanen M, Salonen K, Anasonye F, Cajthaml T, Steffen K, Jorgensen K, Tuomela M. (2016).Bioremediation of PAH-contaminated soil with fungi- From laboratory to field scale. Int. Biodeterior. Biodegradation 86: 238-247.
In article      View Article 
 
[49]  Acevedo F, Pizzul L, Castillo MD, Cuevas R, Diez MC (2011). Degradation of polycyclic aromatic hydrocarbons by the Chilean white-rot fungus Anthracophyllum discolor. J. Hazard. Mater. 185: 212-219.
In article      View Article  PubMed 
 
[50]  Bezalel L,Hadar Y,Fu PP, Freeman JP, Cerniglia C (1996). Metabolism of Phenanthrene by white rot fungus Pleurotus ostreatus .Applied And Environmental Microbiology 62(7): 2547-2553.
In article       PubMed  PubMed 
 
[51]  Sack U, Heinze TM, and Deck J, et al. (1997). Comparison of Phenanthrene and pyrene degradation by different wood-decaying fungi. Appl Environ Microbiol 63: 3919-3925.
In article       PubMed  PubMed 
 
[52]  Vila J, Lopez Z, Sabate J, Minguillon C, Solanas AM, Grifoll M (2001). Identification of a novel Metabolite in the Degradation of Pyrene by Mycobacterium sp. Strain AP1: Actions of the Isolate on Two-and Three-Ring Polycyclic Aromatic Hydrocarbons. Appl Environ Microbiol 67(12): 5497-5505.
In article      View Article  PubMed 
 
[53]  Kottermann MJJ, Rietberg HJ, Hage A, Field JA. (1997). Polycyclic aromatic hydrocarbon oxidation by the white-rot fungus Bjerkandera sp. Strain BOS55 in the presence of non-ionic surfactants. Biotechnol. Bioeng. 57: 220-227.
In article      View Article 
 
[54]  Calvelo, Pereira R, Monterroso C, Macias F. (2010). Phytotoxicity of Hexachlorocyclohexane: Effect on Germination and Early Growth of Different Plant Species, Chemosphere 79: 326-333.
In article      View Article  PubMed 
 
[55]  Somtrakoon K and Chouychai (2013). Phytotoxicity of single and combined polycyclic aromatic hydrocarbons toward economic crops. Russ. J. Plant Physiol. 60(1): 139-148.
In article      View Article