The aim of the present study was to determine the effect of aqueous extract of Tinospora cordifolia (AQTC) on antihyperglycemia, in vitro and in vivo antioxidant, intestinal proglucagon and pancreatic insulin gene expression levels in streptozotocin induced diabetic rats. The AQTC (100, 200 and 400 mg/kg body weight) was administered orally once a daily for 28 days in STZ induced diabetic rats. Serum blood glucose levels, glycosylated hemoglobin (HbA1c), insulin were estimated. Antioxidant enzymes like superoxide dismutase (SOD), catalase (CAT) and malondialdehyde (MDA) were estimated in the pancreas and liver homogenates. Finally the expression levels of pancreatic insulin receptor and intestinal proglucagon gene expression were estimated at the end of 28 days treatment period. The results of the study indicates a significant reduction in blood glucose, HbA1c levels with significant increase in serum insulin and total protein levels with AQTC treatment in diabetic rats and a significant reduction in MDA with elevated levels of SOD, CAT in the pancreas and liver homogenates of diabetic rats compared to normal rats. The expression levels of genes of pancreatic insulin receptor and intestinal proglucagon genes were increased significantly with AQTC treatment. This indicates AQTC has protective effects on expression of intestinal proglucagon, which is precursor for GLP- 1 synthesis and also shown to increase the effects of insulin receptor expression. The protective role of Tinospora cordifolia might be due to the presence of active principles.
Incretins, hormones produced by the gastrointestinal tract in response to nutrient entry, stimulate insulin secretion 1. Incretins were first defined in the 1930’s but the little work was done in the period between 1930 and 1960 because incretin were not believed to be present or have significant physiologic effects. There are many incretin hormones, but the 2 major incretin hormones belong to the glucagon peptide super family. They are gastric inhibitory peptide also known as GIP and GLP-1. GLP-1 may also mediate its effects on glucose-induced stimulation of insulin biosynthesis and secretion, inhibition of glucagon secretion, β-cell proliferation and survival 2. Further important effects of GLP-1 include inhibition of gastrointestinal secretion and motility and food intake 3. However, the half life of GLP-1 is very short (1-2 min) due to the cleavage and inactivation of these proteins by dipeptidyl peptidase IV (DPP IV). Hence, the use of DPP-IV inhibitors increases the GLP-1 time of action 4.
There are several GLP-1 Analogues available in market such as exenatide liraglutide. But the long term use of these drugs produces several side effects as pancreatitis, renal failure, thyroid tumors and GI disturbances such as nausea, diarrhoea 5. Now a day, potential use of herbal drugs was found to be benefit over the use of allopathic medications because of its fewer side effects. Avena sativa 6, Berberis arista 7, Bridella ndellensis 8, Curcuma longa 9, Cymbopogon citrates 10 and Resveratrol 11 are plants reported to have effect on incretins. The activity was reported due to the presence of antioxidant principles. Therefore, studies with plant extracts are useful to understand their efficacy, mechanism of action and safety for treatment and management of diabetes.
Tinospora cordifolia belongs to the family Menispermaceae and is known as Gulancha in English, Guduchi in Sanskrit, and Giloya in Hindi. T. cardifolia may have anti-cancer 12, 13, immune stimulating 14, anti-diabetic 15, 16, cholesterol-lowering 17 and liver-protective 18 actions. T. cordifolia has also shown some promising speed in healing the diabetic foot ulcers 19.
Hence the present work was undertaken with the objective of studying the effect of Tinospora cordifolia for in vitro and in vivo antioxidant activity and their beneficial effect on incretins in STZ induced diabetic rats.
Aqueous stem extract of Tinospora cordifolia (AQTC) was obtained from Lalia Implex, Vijayawada.
2.2. Chemicals and Drugs2, 2-diphenyl-1-picrylhydrazyl (DPPH) was purchased from Sigma Chemical Co. (St.Louis, MO, USA). TRIzol reagent was purchased from GeNei, Bangalore, India. Taq DNA polymerase was acquired from Invitrogen (Carlsbad, CA, USA). Sitagliptin obtained as a gift sample from Sun Pharma Pvt., Ltd., Bangalore. All other chemicals and reagents used were of analytical grade.
2.3. In Vitro Antioxidant ActivitiesThe DPPH scavenging activity of AQTC was measured according to the method of Liu and Zhao., 2006 20. The ability of the AQTC to scavenge hydrogen peroxide was determined according to the method of Ruch et al., 1989 21. According to Winter bourn and Sutton, 1984 22 hydroxyl radical scavenging activity was calculated. Scavenging activity of superoxide anion radical was determined by the method of Stewart and Bewley.,1980 23. The nitric oxide scavenging activity was calculated according to the method of Marcocci et al., 1994 24.The reducing power of the extracts was determined by the method of Oyaizu., 1986 25.
2.4. AnimalsAdult albino Wistar rats (180 ± 10 g bd.wt), Swiss albino mice (18-20 g bd.wt) were obtained from the Mahaveer Enterprizes, Hyderabad, India. They were kept under temperature of (23± 2) ºC, humidity of 50 % and 12 h: 12 h of light and dark cycles, respectively. They were fed with a Commercial pellet diet (Rayon’s Biotechnology Pvt Ltd, India) and water was provided ad libitum. The prior approval for conducting the experiments in rats was obtained from our Institutional Animal Ethics Committee and our lab is approved by CPCSEA, Government of India (Regd. No. 516/01/A/ CPCSEA), AU College of pharmaceutical sciences, Andhra University.
2.5. Acute Toxicity StudiesHealthy adult albino mice of either sex, starved overnight were divided into five groups (n=6). They were orally fed with the AQTC in increasing dose levels of 100, 500, 1000, 1500, 2000 mg/kg bd.wt 26. The animals were observed continuously for 72 h for any signs of behavioral, neurological and autonomic profile, toxicity and mortality.
2.6. Experimental DesignRats were acclimatized to the environment for 15 days prior to the experiment; animals were divided into five groups. Each group contains 6 rats. Fasted animals were deprived of food for at least 16 hr but allowed free access to water. Fasting blood was collected for blood glucose estimation before starting the treatment on the first day. The first group was used as control and received water as vehicle. The second group received a single dose of STZ (60 mg/kg bd.wt) and dissolved in citrate buffer and was divided into four subgroups after establishing of the diabetes for 1 week 27. The first subgroup was kept as a diabetic control while the second, third, fourth and fifth subgroups received orally 1.0 ml of Sitagliptin (5mg/kg), AQTC (100 mg/ kg), AQTC (200 mg/ kg) and AQTC (400 mg /kg) respectively by gastric intubation daily for 28 days. Blood was collected from retro orbital plexus. All five groups were sacrificed on the 28th day in fasting condition by cervical dislocation and then blood was collected for various biochemical estimations.
2.7. Biochemical EstimationAt the end of 28 days the serum blood glucose levels, HbA1C and insulin levels were estimated with kits. The pancreas was isolated and cut into small pieces, place in chilled 0.25 M sucrose solution and blotted on a filter paper. The tissues were then homogenized in 10 % chilled Tris hydrochloride buffer (10 mM, pH 7.4) by tissue Homogenizer (Remi Motors, Mumbai, India) and centrifuged at 12000rpm for 15 min at 0°C using cooling centrifuge (R-247, Refrigerated Centrifuge, Mumbai, India) Lipid peroxidation (LPx) was estimated in terms of malondialdehyde (MDA) content and determined by using the thiobarbituric acid (TBA) by the method of Hiroshi et al., 1979 28. The activity was expressed as μmol of malondialdehyde formed/g wet weight of tissue. Superoxide dismutase (SOD) was assayed for its ability to inhibit the autooxidation of epinephrine in alkaline medium 29. The SOD activity levels were expressed in units per mg protein per min. Catalase was assayed by the method of Maehly and Chance., 1954 30 by determining the decrease in the concentration of hydrogen peroxide [H2O2]. The activity of the enzyme was expressed in μmol of H2O2 metabolized/mg protein/min. The protein concentration was determined by using bovine serum albumin as the standard 31.
2.8. Total RNA Extraction and Reverse Transcription and Polymerase Chain ReactionTotal RNA was isolated from the intestinal samples using TRIzol reagent (GeNei, Bangalore, India) according to manufactures instructions. The quality of RNA was confirmed by formaldehyde gel in comparison with 28S and 18S RNA. The RNA concentration was measured at 260 nm using a UV spectrophotometer (UV-1800 UV-Vis Spectrophotometer, Japan). The RNA pellet was dissolved in diethylpyrocarbonate (DPEC)-treated water. cDNA was synthesized using 9μL of total RNA and reverse transcriptase (Invitrogen, Carlsbad, CA, USA).
Polymerase chain reaction (PCR) was performed on a Thermal Cycler PCR Machine (Model No.LT- 240) using Taq DNA polymerase with the following thermal cycle profiling: initial denaturation at 95°c for 5 min followed by 30 cycles (Denaturation at 95°c for 5 min, annealing at 60°c for 30 Sec, renaturation at 72°c for 30 Sec, and extension at 72°c for 10 min).
The following primer sets were used to amplify proglucagon and insulin gene expression. All the primers were ordered from GeNei, Bangalore, India.
Proglucagon:
Forward:
PLG-F_R: GTAATGCTGGTACAAGGCAG
Reverse:
PLG-R_R: TTGATGAAGTCTCTGGTGGCA
Insulin:
Forward:
INSULIN-F_384: CCCTAAGTGACCAGCTACA
Reverse:
INSULIN-R_384: TTGCAGTAGTTCTCCAGTTG
The in vitro antioxidant activity of AQTC was shown in Table 1. The various concentrations of AQTC and standard ascorbic acid showed antioxidant activity in a dose dependent manner. The IC50 values of AQTC for scavenging of DPPH, hydrogen peroxide, nitric oxide, reducing power, phosphomolybdinum and hydroxyl radical scavenging activity of AQTC extract were 53.91 ± 0.8, 2.91 ± 0.5, 159.4 ±1.2, 21.46 ± 0.4, 106.41 ± 0.9 and 261.8 ± 1.6 μg/ml respectively.
3.2. Effect of AQTC on Blood Glucose, HbA1c and InsulinSTZ induced diabetic rats showed significant increase in blood glucose and HbA1c levels when compared with controls (Table 2). Whereas AQTC and sitagliptin treated diabetic rats showed significant (p<0.05) reduction of blood glucose and HbA1c levels. In diabetic rats insulin levels were decreased significantly (p<0.05) when compared to normal rats, whereas in AQTC treated diabetic rats showed significantly (p<0.05) increase the insulin levels when compared to diabetic rats.
3.3. Effect of AQTC on Protein, Lipid Peroxidation and Antioxidant Enzyme Levels in Pancreas and IntestineThe total protein levels were decreased in diabetic liver and pancreas where as treatment with AQTC showed increased levels of protein levels (Figure 1). The antioxidant enzymes like SOD and catalase levels were significantly (p<0.05) decrease in both pancreas and intestine of diabetic rats. Furthermore, AQTC extract and Sitagliptin when compared to diabetic rats (Figure 2, Figure 3). The MDA contents were significantly (p<0.05) increased in both of the pancreas and liver of diabetic rats when compared to that of normal control rats (Figure IV). However, AQTC and Sitagliptin treated diabetic rats showed significant (p<0.05) decline in MDA contents when compared to diabetic rats.
The pancreatic insulin gene expression levels were significantly (p< 0.05) decreased in diabetic rats when compared to control rats (Figure 6). However, in AQTC and sitagliptin treated diabetic rats insulin gene expression levels and expression fold change were significantly (p< 0.05) increased when compared with diabetic rats (Figure VIII, Figure V). Figure III showed the STZ induced diabetic rats significantly (p<0.05) decreased in intestinal proglucagon gene expression levels as compared to control rats. Whereas, in AQTC and sitagliptin treated diabetic rats, proglucagon gene expression levels and expression fold change were significantly increased (Figure 4, Figure 7) when compared with diabetic rats.
Diabetes mellitus is associated with increased formation of free radicals and decreased antioxidant potential. An imbalance of oxidant/antioxidant defense systems results in alteration in the antioxidant enzyme activity 32. Hyperglycemia causes generation of reactive oxygen species which in turn causes lipid peroxidation. AQTC extract possesses significant antioxidant activity in various in vitro models, it may be due to AQTC extract contains compounds that are electron donors, which can react with free radicals to convert them to more stable products and terminate radical chain reaction. In the present study AQTC extract shows significant in vitro antioxidant activity when compared to ascorbic acid (Table 1).
In this study, Streptozotocin (STZ) is used to induce diabetes mellitus in albino Wistar rats. The treatment with the aqueous extract of Tinospora cordifolia (AQTC) significantly (p<0.05) reduced the elevated plasma glucose levels in STZ induced diabetic rats (Table II). The AQTC was shown delayed absorption in diabetic animals when compared to normoglycemic animals, which might be due to delayed gastric absorption, motility and nervous control of the entire system of gastrointestinal tract during diabetic condition. The AQTC was shown to have elevated insulin levels in STZ induced diabetic rats might be due to the controlled blood glucose levels (Table 2).
Glycosylated hemoglobin was an indicator of irreversible condensation of glucose with the N terminal residue of the β-chain of hemoglobin 33. In our study, the diabetic rats had higher levels of glycosylated haemoglobin, the significant decrease in glycosylated hemoglobin was observed in diabetic rats after treatment with AQTC extract indicates that the overall blood glucose levels were controlled which might be due to an improvement in insulin secretion (Table 2).
The estimation of total protein is useful for measuring gross changes in protein levels caused by various disease states. The protein concentrations in liver and pancreas of the diabetic groups were found to be decreased. These decreased protein concentration in STZ induced diabetic rats was found to raised back to normal with AQTC treatment (Figure 1).
The SOD plays a pivotal role in oxygen defense metabolism by reducing superoxide to hydrogen peroxide 34. The decrease in SOD activity in diabetic rats could result from inactivation of H2O2 or by glycosylation of the enzyme which have been reported to occur in diabetes 35. The AQTC showed to elevate the SOD levels in both liver and pancreas as shown in Figure 2. The enzymes CAT and GPx are involved in the elimination of H2O2 36. The CAT activity in liver and pancreas was found to decrease due to inactivation by superoxide radical and glycation of the enzyme by the treatment with AQTC extract (Figure 2, Figure 3). Also, CAT is involved in detoxification of high H2O2 concentration 37. AQTC extract treated diabetic rats pancreatic antioxidant enzymes were significantly increased which could be attributable to strong antioxidative properties 38. In the present study in STZ induced diabetic rats, MDA content was increased. Treatment with AQTC extract for 28 days significantly reduced the liver and pancreatic MDA content (Figure 4).
GLP-1 is produced by differential posttranslational processing of proglucagon in the gut and brain 39. Proglucagon is cleaved to glucagon by prohormone convertase 2 (PC2) in pancreatic α-cells, but is cleaved to glucagon-like peptide-1 (GLP-1) by PC1 in intestinal L-cells 40. The aim of this study was to identify mechanisms which switch processing of proglucagon to generate GLP-1 in the pancreas; given that GLP-1 can increase insulin secretion and β-cell mass. GLP-1 slows gastric emptying, inhibits gut motility, and suppresses appetite while it increases β cells proliferation, enhances β cells function, and stimulates pancreatic insulin secretion 41. The insulin stimulating effect of GLP-1 is tightly regulated by the blood glucose concentration. In Figure 6 and Figure IX showed that the AQTC normalize the blood glucose levels and insulin levels as well as increase the expression of pancreatic insulin expression and intestinal proglucagon expression to enhance the GLP-1 secretion in STZ induced diabetic rats, this may be attributed the presence of photochemicals such as alkaloids, glycosides and steroids 42.
The anti-diabetic properties, in vitro and in vivo antioxidant activity and enhanced expression of insulin and proglucagon due to enhancing GLP-1 expression levels in STZ induced diabetic rats. The activities are attributed due to the presence of alkaloids, tannins, cardiac glycosides, flavonoids, saponins, steroids in Tinospora cordifolia.
The author acknowledges the financial support from Major Research Project, University Grants Commission [UGC], New Delhi [Grant No. 41-717/2012 [SR].
| [1] | MacDonald, P.E., El-Kholy, W., Riedel, M.J, “The multiple actions of GLP-1 on the process of glucosestimulated insulin secretion”, Diabetes 51,434- 442, 2000. | ||
| In article | View Article PubMed | ||
| [2] | Deacon, C.F, “What do we know about the secretion and degradation of incretin hormones?”, Regul Pept, 128, 117-124, 2005. | ||
| In article | View Article PubMed | ||
| [3] | Naslund, E., Bogefors, J., Skogar, S., Gryback, P., Jacobsson, H, “GLP-1 slows solid gastric emptying and inhibits insulin, glucagon, and PYY release in humans”. Am J Physiol, 277, 910-916, 1999. | ||
| In article | View Article PubMed | ||
| [4] | Stephan, M., Radicke, A., Leutloff, S, “Dipeptidyl peptidase IV [DPP4]- deficiency attenuates diet-induced obesity in rats: possible implications for the hypothalamic neuropeptidergic system”, Behav Brain Res, 216, 712-718, 2001. | ||
| In article | View Article PubMed | ||
| [5] | Vishal, G, “Glucagon-like peptide-1 analogues: An overview”. Ind J Endo Met, 17, 413-421, 2013. | ||
| In article | View Article PubMed PubMed | ||
| [6] | Wani Sajad, A., Shah Tajamul, R., Bazaria, B, “Oats as a Functional Food: A Review. Universsal”, J Pharm, 03 (01):14-20, 2014. | ||
| In article | |||
| [7] | Rituparna, C., Singh, B., Prakrith, N, “Dipeptidyl Peptidase- IV Inhibitory Activity of Berberis aristata”, J. Natural. Products, 158-163, 2011. | ||
| In article | |||
| [8] | Sokengb, S.D., Rokeya, M., Mostafa, N, “Antihyperglycemic effect of Bridelia ndellensis ethanol extract and fractions in streptozotocin-induced diabetic rats”, Afr J Trad CAM, 2, 94-102, 2005. | ||
| In article | View Article | ||
| [9] | Mohammed, T.A.A., Mohammed, F.E.A., Ameen, M.R, “Effects of a novel curcumin derivative on insulin synthesis and secretion in streptozotocin-treated rat pancreatic islets in vitro”, Chinese Medicine, 9, 3, 2014. | ||
| In article | View Article PubMed PubMed | ||
| [10] | Sudhanshu Kumar, B., Amit, K., Om Prakash, “Essential Oil of Cymbopogon citratus against Diabetes: Validation by in vivo Experiments and Computational Studies”, J Bio Med 2,1-9, 2014; | ||
| In article | |||
| [11] | ThiMai, A.D., Aure, W., Pascale, K, “Resveratrol Increases Glucose Induced GLP-1 Secretion in Mice: A Mechanism which Contributes to the Glycemic Control”, PLOS One, 6, 20700, 2011. | ||
| In article | View Article PubMed PubMed | ||
| [12] | Singh, N., Singh, S.M., Shrivastava, P, “Immunomodulatory and antitumor actions of medicinal plant Tinospora cordifolia are mediated through activation of tumor-associated macrophages, Immunotoxicol, 26, 145-62, 2004. | ||
| In article | View Article PubMed | ||
| [13] | Singh, N., Singh, S.M., Shrivastava, P, “Effect of Tinospora cordifolia on the antitumor activity of tumor-associated macrophages-derived dendritic cells” Immunopharmacol Immunotoxicol, 27, 1-14, 2005. | ||
| In article | View Article PubMed | ||
| [14] | Rawal, A.K., Muddeshwar, M.G., Biswas, S.K, “Rubia cordifolia, Fagonia cretica linn and Tinospora cordifolia exert neuroprotection by modulating the antioxidant system in rat hippocampal slices subjected to oxygen glucose deprivation”, BMC Compl Altern Med, 4,11, 2004. | ||
| In article | View Article PubMed PubMed | ||
| [15] | Stanely, P., Prince, M., Menon, V.P, “Hypoglycaemic and other related actions of Tinospora cordifolia roots in alloxan-induced diabetic rats”, J Ethnopharmacol, 70, 9-15, 2000. | ||
| In article | View Article | ||
| [16] | Rathi, S.S., Grover, J.K., Vikrant, V, “Prevention of experimental diabetic cataract by Indian Ayurvedic plant extracts”, Phytother Res, 16, 774-7, 2002. | ||
| In article | View Article PubMed | ||
| [17] | Stanely, M.P., Menon, V.P, “Hypoglycaemic and hypolipidaemic action of alcohol extract of Tinospora cordifolia roots inchemical induced diabetes in rats”, Phytother Res, 17, 410-3, 2003. | ||
| In article | View Article PubMed | ||
| [18] | Bishayi, B., Roychowdhury, S., Ghosh, S, “Hepatoprotective and immunomodulatory properties of Tinospora cordifolia in CCl4 intoxicated mature albino rats”, J Toxicol Sci, 27, 139-46, 2002. | ||
| In article | View Article PubMed | ||
| [19] | Purandare, H., Supe, A, “Immunomodulatory role of Tinospora cordifolia as an adjuvant in surgical treatment of diabetic foot ulcers: A prospective randomized controlled study”, Indian J Med Sci, 61, 347-355, 2007. | ||
| In article | View Article PubMed | ||
| [20] | Liu, X., Zhao, M, “Antioxidant activities and functional composition content of selected Phyllanthus emblica fruits juice”, Food Ferment Ind 2006; 5: 151-154. | ||
| In article | |||
| [21] | Ruch, R.J., Cheng, S.J., Klaunig, J.E, “Prevention of cytotoxicity and inhibition of intracellular communication by antioxidant catechins isolated from Chinese green tea”, Carcinogenesis, 10, 1003-1008, 1989. | ||
| In article | View Article PubMed | ||
| [22] | Winterbourn, C.C., Sutton, H.C, “Hydroxyl radical production from hydrogen peroxide and enzymatically generated paraquat radicals: catalytic requirements and oxygen dependence”, Arch Biochem Biophys, 235, 116-126, 1984. | ||
| In article | View Article | ||
| [23] | Stewart, R.R., Bewley, J.D, “Lipid peroxidation associated aging of soybean axes”, Plant Physiology, 65, 245-248, 1980. | ||
| In article | View Article PubMed PubMed | ||
| [24] | Marcocci, I., Marguire, J.J., Droylefaiz, M.T, “The nitric oxide scavenging properties Ginkgo biloba extract”, Biochem Biophys Res Commun, 201, 748-755, 1994. | ||
| In article | View Article PubMed | ||
| [25] | Oyaizu, M, “Studies on products of browning reactions: antioxidative activities of products of browning reaction prepared from glucosamine”, Japan J Nutr, 44, 307-315, 1986. | ||
| In article | View Article | ||
| [26] | OECD. OECD Guidelines for Acute Toxicity of Chemicals; Organisation for Economic Co-operation and Development: Paris, France, 2001, 420. | ||
| In article | |||
| [27] | Sabitha, V., Ramachandran, S., Naveen, K.R, “Antidiabetic and antihyperlipidemic potential of Abelmoschus esculentus [L.] Moench. in streptozotocin-induced diabetic rats”, J Pharm Bioallied Sci, 397-402, 2011. | ||
| In article | View Article PubMed PubMed | ||
| [28] | Hiroshi, O., Ohishi, N., Yagi, K, “Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction”, Aiial. Biochem, 95, 351-358, 1979. | ||
| In article | View Article | ||
| [29] | Misra, H.P., Fridovich, I, “The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase”, J Biol Chem, 247, 3170-3175, 19972. | ||
| In article | |||
| [30] | Maehly, B, “The assay of Catalases and Peroxidases. Methods”, Biochem. Anal, 1, 357-424, 1954. | ||
| In article | View Article | ||
| [31] | Lowry, H., Rosebrough, N.I., Far, A.L, “Protein measurement with folin phenol reagent”, J Biol Chem, 193, 265-275, 1951. | ||
| In article | |||
| [32] | Maritim, A.C., Sanders, R.A., Watkins, J.B, “Diabetes, oxidative stress, and antioxidants: a review”, J Biochem Toxicol, 17, 24-38, 2003. | ||
| In article | View Article PubMed | ||
| [33] | O'Hea, E.L., Moon, S., Grothe, K.B., Boudreaux, E., Bodenlos, “The interaction of locus of control, self-efficacy and outcome expectancy in relation to HbA1c in medically underserved individuals with type 2 diabetes”, J Behav Med, 32,106-117, 2009. | ||
| In article | View Article PubMed | ||
| [34] | Blokhina, O., Virolainen, E., Fagerstedt, K.V, “Antioxidants, oxidative damage and oxygen deprivation stress: a review”, Ann Bot, 91, 179-194, 2003 | ||
| In article | View Article PubMed PubMed | ||
| [35] | Ravi, K, “Protective effect of Eugenia jambolaa seed kernel on tissue antioxidants in streptozotocin-induced diabetic rats”, Biol Pharm Bull. 27, 1212-1217, 2004. | ||
| In article | View Article PubMed | ||
| [36] | Freeman, B.C, Crapo, J.D, “Biology of disease. Free radicals and tissue injury”, Lab Invest, 47,412-426, 1982. | ||
| In article | |||
| [37] | Bagri, P., Ali, M., Aeri, V., Bhowmik, M, “Antidiabetic effect of Punica granatum flowers: effect on hyperlipidemia, pancreatic cells lipid peroxidation and antioxidant enzymes in experimental diabetes”, Food ChemToxicol, 47, 50-54, 2009. | ||
| In article | View Article PubMed | ||
| [38] | Althunibat, O.Y., Al-Mustafa, A.H., Tarawneh, K, “Protective role of Punica granatum L. peel extract against oxidative damage in experimental diabetic rats. Process”, Biochem, 45, 581-585, 2010. | ||
| In article | View Article | ||
| [39] | Holst, J.J, “The physiology of glucagon-like peptide 1, Physiological Reviews” 87, 1409-1439, 2007. | ||
| In article | View Article PubMed | ||
| [40] | Whalley, N.M., Pritchard, L.E., Smith, D.M, “Processing of proglucagon to GLP-1 in pancreatic α-cells: is this a paracrine mechanism enabling GLP-1 to act on β-cells?”, J Endocrinol , 211, 99-106, 2011. | ||
| In article | View Article PubMed | ||
| [41] | Baggio, L.L., Drucker, D.J, Biology of incretins: GLP-1 and GIP, Gastroenterology, 132, 2131-2157, 2007. | ||
| In article | View Article PubMed | ||
| [42] | Krish, S., Mishra, N.P., Singh, J, “Tinospora cordifolia (Guduchi), a reservoir plant for therapeutic applications: A Review”, Ind J Tra Knowl, 3, 257-270, 2004. | ||
| In article | |||
Published with license by Science and Education Publishing, Copyright © 2019 Eswar Kumar Kilari, Swathi Putta, Kotaiah Silakabattini and Neelakantam Nagireddy
This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/
| [1] | MacDonald, P.E., El-Kholy, W., Riedel, M.J, “The multiple actions of GLP-1 on the process of glucosestimulated insulin secretion”, Diabetes 51,434- 442, 2000. | ||
| In article | View Article PubMed | ||
| [2] | Deacon, C.F, “What do we know about the secretion and degradation of incretin hormones?”, Regul Pept, 128, 117-124, 2005. | ||
| In article | View Article PubMed | ||
| [3] | Naslund, E., Bogefors, J., Skogar, S., Gryback, P., Jacobsson, H, “GLP-1 slows solid gastric emptying and inhibits insulin, glucagon, and PYY release in humans”. Am J Physiol, 277, 910-916, 1999. | ||
| In article | View Article PubMed | ||
| [4] | Stephan, M., Radicke, A., Leutloff, S, “Dipeptidyl peptidase IV [DPP4]- deficiency attenuates diet-induced obesity in rats: possible implications for the hypothalamic neuropeptidergic system”, Behav Brain Res, 216, 712-718, 2001. | ||
| In article | View Article PubMed | ||
| [5] | Vishal, G, “Glucagon-like peptide-1 analogues: An overview”. Ind J Endo Met, 17, 413-421, 2013. | ||
| In article | View Article PubMed PubMed | ||
| [6] | Wani Sajad, A., Shah Tajamul, R., Bazaria, B, “Oats as a Functional Food: A Review. Universsal”, J Pharm, 03 (01):14-20, 2014. | ||
| In article | |||
| [7] | Rituparna, C., Singh, B., Prakrith, N, “Dipeptidyl Peptidase- IV Inhibitory Activity of Berberis aristata”, J. Natural. Products, 158-163, 2011. | ||
| In article | |||
| [8] | Sokengb, S.D., Rokeya, M., Mostafa, N, “Antihyperglycemic effect of Bridelia ndellensis ethanol extract and fractions in streptozotocin-induced diabetic rats”, Afr J Trad CAM, 2, 94-102, 2005. | ||
| In article | View Article | ||
| [9] | Mohammed, T.A.A., Mohammed, F.E.A., Ameen, M.R, “Effects of a novel curcumin derivative on insulin synthesis and secretion in streptozotocin-treated rat pancreatic islets in vitro”, Chinese Medicine, 9, 3, 2014. | ||
| In article | View Article PubMed PubMed | ||
| [10] | Sudhanshu Kumar, B., Amit, K., Om Prakash, “Essential Oil of Cymbopogon citratus against Diabetes: Validation by in vivo Experiments and Computational Studies”, J Bio Med 2,1-9, 2014; | ||
| In article | |||
| [11] | ThiMai, A.D., Aure, W., Pascale, K, “Resveratrol Increases Glucose Induced GLP-1 Secretion in Mice: A Mechanism which Contributes to the Glycemic Control”, PLOS One, 6, 20700, 2011. | ||
| In article | View Article PubMed PubMed | ||
| [12] | Singh, N., Singh, S.M., Shrivastava, P, “Immunomodulatory and antitumor actions of medicinal plant Tinospora cordifolia are mediated through activation of tumor-associated macrophages, Immunotoxicol, 26, 145-62, 2004. | ||
| In article | View Article PubMed | ||
| [13] | Singh, N., Singh, S.M., Shrivastava, P, “Effect of Tinospora cordifolia on the antitumor activity of tumor-associated macrophages-derived dendritic cells” Immunopharmacol Immunotoxicol, 27, 1-14, 2005. | ||
| In article | View Article PubMed | ||
| [14] | Rawal, A.K., Muddeshwar, M.G., Biswas, S.K, “Rubia cordifolia, Fagonia cretica linn and Tinospora cordifolia exert neuroprotection by modulating the antioxidant system in rat hippocampal slices subjected to oxygen glucose deprivation”, BMC Compl Altern Med, 4,11, 2004. | ||
| In article | View Article PubMed PubMed | ||
| [15] | Stanely, P., Prince, M., Menon, V.P, “Hypoglycaemic and other related actions of Tinospora cordifolia roots in alloxan-induced diabetic rats”, J Ethnopharmacol, 70, 9-15, 2000. | ||
| In article | View Article | ||
| [16] | Rathi, S.S., Grover, J.K., Vikrant, V, “Prevention of experimental diabetic cataract by Indian Ayurvedic plant extracts”, Phytother Res, 16, 774-7, 2002. | ||
| In article | View Article PubMed | ||
| [17] | Stanely, M.P., Menon, V.P, “Hypoglycaemic and hypolipidaemic action of alcohol extract of Tinospora cordifolia roots inchemical induced diabetes in rats”, Phytother Res, 17, 410-3, 2003. | ||
| In article | View Article PubMed | ||
| [18] | Bishayi, B., Roychowdhury, S., Ghosh, S, “Hepatoprotective and immunomodulatory properties of Tinospora cordifolia in CCl4 intoxicated mature albino rats”, J Toxicol Sci, 27, 139-46, 2002. | ||
| In article | View Article PubMed | ||
| [19] | Purandare, H., Supe, A, “Immunomodulatory role of Tinospora cordifolia as an adjuvant in surgical treatment of diabetic foot ulcers: A prospective randomized controlled study”, Indian J Med Sci, 61, 347-355, 2007. | ||
| In article | View Article PubMed | ||
| [20] | Liu, X., Zhao, M, “Antioxidant activities and functional composition content of selected Phyllanthus emblica fruits juice”, Food Ferment Ind 2006; 5: 151-154. | ||
| In article | |||
| [21] | Ruch, R.J., Cheng, S.J., Klaunig, J.E, “Prevention of cytotoxicity and inhibition of intracellular communication by antioxidant catechins isolated from Chinese green tea”, Carcinogenesis, 10, 1003-1008, 1989. | ||
| In article | View Article PubMed | ||
| [22] | Winterbourn, C.C., Sutton, H.C, “Hydroxyl radical production from hydrogen peroxide and enzymatically generated paraquat radicals: catalytic requirements and oxygen dependence”, Arch Biochem Biophys, 235, 116-126, 1984. | ||
| In article | View Article | ||
| [23] | Stewart, R.R., Bewley, J.D, “Lipid peroxidation associated aging of soybean axes”, Plant Physiology, 65, 245-248, 1980. | ||
| In article | View Article PubMed PubMed | ||
| [24] | Marcocci, I., Marguire, J.J., Droylefaiz, M.T, “The nitric oxide scavenging properties Ginkgo biloba extract”, Biochem Biophys Res Commun, 201, 748-755, 1994. | ||
| In article | View Article PubMed | ||
| [25] | Oyaizu, M, “Studies on products of browning reactions: antioxidative activities of products of browning reaction prepared from glucosamine”, Japan J Nutr, 44, 307-315, 1986. | ||
| In article | View Article | ||
| [26] | OECD. OECD Guidelines for Acute Toxicity of Chemicals; Organisation for Economic Co-operation and Development: Paris, France, 2001, 420. | ||
| In article | |||
| [27] | Sabitha, V., Ramachandran, S., Naveen, K.R, “Antidiabetic and antihyperlipidemic potential of Abelmoschus esculentus [L.] Moench. in streptozotocin-induced diabetic rats”, J Pharm Bioallied Sci, 397-402, 2011. | ||
| In article | View Article PubMed PubMed | ||
| [28] | Hiroshi, O., Ohishi, N., Yagi, K, “Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction”, Aiial. Biochem, 95, 351-358, 1979. | ||
| In article | View Article | ||
| [29] | Misra, H.P., Fridovich, I, “The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase”, J Biol Chem, 247, 3170-3175, 19972. | ||
| In article | |||
| [30] | Maehly, B, “The assay of Catalases and Peroxidases. Methods”, Biochem. Anal, 1, 357-424, 1954. | ||
| In article | View Article | ||
| [31] | Lowry, H., Rosebrough, N.I., Far, A.L, “Protein measurement with folin phenol reagent”, J Biol Chem, 193, 265-275, 1951. | ||
| In article | |||
| [32] | Maritim, A.C., Sanders, R.A., Watkins, J.B, “Diabetes, oxidative stress, and antioxidants: a review”, J Biochem Toxicol, 17, 24-38, 2003. | ||
| In article | View Article PubMed | ||
| [33] | O'Hea, E.L., Moon, S., Grothe, K.B., Boudreaux, E., Bodenlos, “The interaction of locus of control, self-efficacy and outcome expectancy in relation to HbA1c in medically underserved individuals with type 2 diabetes”, J Behav Med, 32,106-117, 2009. | ||
| In article | View Article PubMed | ||
| [34] | Blokhina, O., Virolainen, E., Fagerstedt, K.V, “Antioxidants, oxidative damage and oxygen deprivation stress: a review”, Ann Bot, 91, 179-194, 2003 | ||
| In article | View Article PubMed PubMed | ||
| [35] | Ravi, K, “Protective effect of Eugenia jambolaa seed kernel on tissue antioxidants in streptozotocin-induced diabetic rats”, Biol Pharm Bull. 27, 1212-1217, 2004. | ||
| In article | View Article PubMed | ||
| [36] | Freeman, B.C, Crapo, J.D, “Biology of disease. Free radicals and tissue injury”, Lab Invest, 47,412-426, 1982. | ||
| In article | |||
| [37] | Bagri, P., Ali, M., Aeri, V., Bhowmik, M, “Antidiabetic effect of Punica granatum flowers: effect on hyperlipidemia, pancreatic cells lipid peroxidation and antioxidant enzymes in experimental diabetes”, Food ChemToxicol, 47, 50-54, 2009. | ||
| In article | View Article PubMed | ||
| [38] | Althunibat, O.Y., Al-Mustafa, A.H., Tarawneh, K, “Protective role of Punica granatum L. peel extract against oxidative damage in experimental diabetic rats. Process”, Biochem, 45, 581-585, 2010. | ||
| In article | View Article | ||
| [39] | Holst, J.J, “The physiology of glucagon-like peptide 1, Physiological Reviews” 87, 1409-1439, 2007. | ||
| In article | View Article PubMed | ||
| [40] | Whalley, N.M., Pritchard, L.E., Smith, D.M, “Processing of proglucagon to GLP-1 in pancreatic α-cells: is this a paracrine mechanism enabling GLP-1 to act on β-cells?”, J Endocrinol , 211, 99-106, 2011. | ||
| In article | View Article PubMed | ||
| [41] | Baggio, L.L., Drucker, D.J, Biology of incretins: GLP-1 and GIP, Gastroenterology, 132, 2131-2157, 2007. | ||
| In article | View Article PubMed | ||
| [42] | Krish, S., Mishra, N.P., Singh, J, “Tinospora cordifolia (Guduchi), a reservoir plant for therapeutic applications: A Review”, Ind J Tra Knowl, 3, 257-270, 2004. | ||
| In article | |||