Article Versions
Export Article
Cite this article
  • Normal Style
  • MLA Style
  • APA Style
  • Chicago Style
Research Article
Open Access Peer-reviewed

Bioprospecting for Cellulase-Producing Bacteria from Victoria Falls Rainforest Decaying Logs

Makhosazana Nyathi , Zephaniah Dhlamini, Thembekile Ncube
American Journal of Microbiological Research. 2023, 11(3), 73-78. DOI: 10.12691/ajmr-11-3-2
Received September 07, 2023; Revised October 08, 2023; Accepted October 15, 2023

Abstract

Bioprospecting for cellulases seeks to find highly active enzymes that are stable, affordable, and can be readily incorporated into industrial processes. Research focus is shifting from fungal to bacterial cellulases due to the latter having higher growth rates, being easy to handle, and being more adaptable to genetic manipulations. In this research, bioprospecting for cellulolytic bacteria was carried out in decaying logs and soils sampled from the Victoria Falls rainforest. A compound sample of decaying logs and soils was inoculated on Mandel's media to isolate cellulase-producing bacteria. Morphological and biochemical analysis of the bacterial isolates was carried out to identify unique isolates showing cellulase production. Two Gram-negative and two Gram-positive isolates were selected and subsequently identified as Acinetobacter sp 9, Enterobacter sp, Bacillus thuringensis, and Bacillus cereus strain HYM88 by 16S rDNA sequencing. Submerged fermentation of the selected cellulase-producing bacteria was carried out for cellulase production. The cellulases were partially characterized to determine their optimum pH and temperature for activity. The optimum cellulase activity from all the bacterial isolates was at pH 5 and 50 °C. The diversity of the cellulases produced was determined. All the bacterial isolates proved to be true cellulolytic bacteria as they produced both exoglucanases and endoglucanases. All the bacterial isolates produced more exoglucanases than endoglucanases by 80 to 90%. The isolated cellulase-producing bacteria are a reflection of Victoria Falls rain forest's potential as an enzyme bioprospecting site which is yet to be tapped.

1. Introduction

Bioprospecting for enzymes can be defined as the exploration of biodiversity for valuable enzymes or their genetic resources 1. Cellulases are inducible enzymes that hydrolyze cellulose to low molecular weight compounds such as hexoses, pentoses, cellobiose, and finally to glucose 2. Bioprospecting for cellulases is focused on finding cellulases that are affordable, highly active, and stable under the various production conditions used in industries 3. Cellulases are of interest due to their applicability in diverse industries such as the bio-polishing of fabrics in the textile industry, improving the digestibility of animal feeds, and as clarifiers in fruit juice processing in the food industry 4.

Cellulose is a crystalline polymer composed of D-glucose residues connected by β-1, 4 glycosidic linkages 5. The polymer is the primary structural material of plant cell walls and is the most abundant biopolymer on earth as it is continuously synthesized by photosynthesis 6.

Cellulases are synthesized by various microorganisms, either cell-bound or extracellular, as the microbes grow on cellulosic substrates. Fungi and bacteria produce cellulases that decompose cellulosic biomass. Industrial cellulases are mostly produced by fungi in submerged fermentation because of the ease of handling and greater control of environmental factors such as temperature and pH 7. However, bacteria have much higher growth rates, are easy to handle, and are adaptable to all environmental niches including the extremes such as thermophilic and halophilic 8. Research focus is being directed towards cellulolytic bacteria because of their advantages over fungi 9. With the advent of recombinant DNA technology, the greatest advantage of bacteria over fungi is their adaptability to genetic manipulations. As a result, the isolation and characterization of cellulase-producing bacteria has become a principal component of enzyme research.

Over the years, bioprospecting for cellulases has been carried out on a wide variety of sources such as composting heaps, decaying plant material from forestry or agricultural waste, the feces of ruminants such as cows, soil and organic matter, and extreme environments like hot-springs 9. Forest floors harbor a diversity of microorganisms that contribute substantially to the degradation of forest litter by secreting enzymes with different cellulolytic activities 10.

The Victoria Falls rainforest is an undisturbed environment protected by the Zimbabwean National Conservation Act (1998) 11. The forest is highly humid and largely undisturbed, which may contribute to great microbial diversity. The decomposition of the varied plant biomass in the rainforest is carried out by a community of microorganisms whose cellulolytic potential could be of value to research. In this project cellulase-producing bacteria from the Victoria Falls rainforest were explored and their cellulases were characterized.

2. Materials and Methods

2.1. Sampling

Sampling was carried out at the Victoria Falls rainforest. Logs with visible signs of decomposition were collected by breaking using gloved hands into sterile sampling bags along with soil from underneath the logs. The sampling was not selective of wood type; both hard woods and soft woods were included. A compound sample was prepared by pounding the various log fragments and soils into a fine powder, 20 g of which was suspended in 180 ml sterile distilled water and incubated overnight at room temperature with shaking at 120 rpm. After incubation, the compound sample was used for culturing cellulase-producing bacteria.

2.2. Isolation of Culturable Cellulase Producing Bacteria

The different culture media used were prepared according to the manufacturer’s instructions. Culture media used included Luria-Bertani (LB) broth and agar, Simmons citrate agar, motility test agar, and Mandel's medium. The composition of the Mandel’s medium used was carboxymethyl cellulose (CMC), 10; NH4SO4, 1.4; KH2PO4, 2; Urea, 0.3; CaCl2, 0.4; MgSO4, 0.6 in g/L) and trace elements MnSO4, 1 mg; ZnSO4, 1.4 mg; CoCl2, 3.7 mg according to 12.

2.3. Screening and Isolation of Cellulase Producing Bacteria

Appropriate dilutions of the compound sample were done after which the spread plate technique was used for inoculation of the plates. After incubation at 28 °C for 24 hours and 48 hours (for slow growers), colonies were picked for purification. The previously incubated plates were flooded with Gram’s iodine according to 13. Morphological and biochemical characteristics of the cellulase-producing bacterial isolates were used to select those to be analyzed further.

2.4. Molecular Identification of the Selected Cellulase-Producing Bacteria

The selected bacterial isolates were cultured overnight in LB broth for DNA isolation. The DNA was isolated from the overnight cultures using the phenol-chloroform method 14.

The 16S rDNA gene was amplified from the genomic of each isolate using universal primers; fD1 AGAGTTTGATCCTGGCTCAG and rD1 5’AAGGAGGTGATCCAGCC 15. The 16S rDNA amplicons were sequenced at Inqaba Biotech, Pretoria, South Africa using the 3500 Sanger Sequencer. Raw sequences were edited using the Genomics Workbench 8 (QIAGEN, Aarhus, Denmark). The bacterial isolates were identified using sequence similarity searches using the Basic Local Alignment Search Tool (BLAST) in the National Center for Biotechnology Information (NCBI) database.

2.5. Characterisation of Cellulases from the Isolated Bacteria
2.5.1. Production of Cellulases by the Selected Bacterial Isolates

The bacterial isolates were pre-cultured overnight in LB broth at 28 °C and shaken at 160 rpm 16. After incubation, 2 ml of the culture was inoculated into 50 ml of Mandel's medium broth enriched with 1 % CMC as the sole source of carbon. Incubation was at 28 °C for 72 hours with shaking at 160 rpm. After incubation, the cultures were centrifuged at 5000 g for 15 minutes at 4 °C and the supernatants were collected as crude enzymes for detection of cellulases 17.


2.5.2. Assaying of Enzymes Produced by the Selected Bacterial Isolates

Cellulase activity was measured by use of 3, 5-dinitrosalicyclic acid (DNS) 18, through the determination of the amount of reducing sugars liberated from substrates in 50 mM citrate buffer at pH 5. The method was scaled down to micro-titre volumes, which were 25 µl substrate, 25 µl of buffer, and 25 µl of crude enzyme 19. For the endoglucanase assay, the mixture was incubated at 50 °C for 30 minutes whilst for exoglucanase assay incubation time was 1 hour at the same temperature. The micro-titre-based filter paper assay was carried out for total cellulases by incubating a 7 mm disc of Whatman No. 1 filter paper in crude enzyme and 40 µl of 50 mM Citrate buffer pH 5 for 1 hour at 50 °C 20. The reactions were stopped by the addition of DNS reagent and boiling for 5 minutes at 100 °C for color development. The absorbance of the reaction mixtures was read at 540 nm. A calibration curve of glucose standard solutions was used to determine the amount of glucose produced. One unit of enzyme activity was defined as the amount of enzyme that released 1 μmol of glucose per minute.


2.5.3. Determination of Enzyme Production by the Bacterial Isolates Over Time

The selected bacterial isolates were cultured in Mandel's broth at 28 ºC with agitation at 160 rpm for 120 hours. A volume of 2 ml of the broth was aseptically withdrawn from the cultures at 24-hour intervals and centrifuged at 10,000 rpm for 5 minutes. The obtained supernatants were assayed for cellulase activity over time as in section 2.4.2.


2.5.4. Determination of the Enzyme's Optimum Temperature of Activity

The optimum temperature for enzyme activity was determined by incubating the crude enzyme in either 1% CMC, 1 % Avicel, or 7 mm filter paper discs at temperatures 45, 50, 55, 60, and 70 °C for 5 minutes 21. Production of reducing sugars was then determined using DNS as described in section 2.4.2


2.5.5. Determination of Optimum pH for Cellulase Activity

To determine the optimum pH for cellulase activity, 1% CMC, 1 % Avicel, or 7 mm filter paper discs were prepared in 10 mM buffer solutions in the 4- 9 pH range (acetate buffer for pH 4 and 5, phosphate buffer for pH 6 and sodium for 7 and Tris-HCl for pH 8 and 9). The substrates were then incubated with 0.1 ml of the crude enzymes at their optimum temperatures. Production of reducing sugar was determined using the DNS reagent as in section 2.4.2.


2.5.6. Determination of the Diversity of Cellulases Produced by the Selected Bacterial Isolates

Crude enzymes sampled at optimum production time for each bacterial isolate were used to determine the diversity of cellulases produced by the bacterial isolates. Enzyme assays were carried out at optimum temperatures and pH for each bacterial isolate as determined in sections 2.4.4 and 2.4.5 respectively. Production of reducing sugars from the exoglucanase, endoglucanase, and total cellulases was determined using the DNS reagent as in section 2.4.2.

3. Results

3.1. Screening and Isolation of Cellulase Producing Bacteria

After 48 hours of incubation, the Mandels media plate inoculated with composite sample had a total of 8.1 Х 10 6 cfu/g of sample. Biochemical tests and morphological analysis of the bacterial isolates were used to select those with unique characteristics to avoid duplication. Enterobacter sp and Acinetobacter sp 9 were the two Gram-negative rod-shaped isolates selected. Two Gram-positive spore-forming, rod-shaped isolates were selected Bacillus cereus strain HYM88 and Bacillus thuringensis. Figure 1 shows the selected isolates spot inoculated on Mandel's media and flooded with Grams iodine to measure clearance zones surrounding the colony. Bacillus cereus strain HYM88 had the largest clearance zone measuring 3.5 mm. Enterobacter sp and Bacillus thuringensis had a zone of clearance measuring 3 mm. Acinetobacter sp 9 had a clearance zone measuring 2.5 mm.

3.2. Molecular Identification of the Selected Cellulase-Producing Bacteria

Genomic DNA was isolated from the selected cellulase-producing bacterial isolates and their 16S rRNA genes amplified resulting in amplicons of size 1500 bp as shown in Figure 2.

The 16S rDNA sequences of the cellulase-producing bacterial isolates were subjected to the BLAST similarity search. The bacterial isolates were identified as Enterobacter sp, Bacillus thuringensis, Acinetobacter sp 9, and Bacillus cereus strain HYM88.

3.3. Characterisation of Cellulases from the Isolated Bacteria.

The selected cellulase-producing bacteria Enterobacter sp, Bacillus cereus strain HYM88, Bacillus thuringiensis, and Acinetobacter sp 9 cellulase were used for enzyme production.


3.3.1. Production of Cellulases by Bacterial Isolates Over Time

Optimum production of exoglucanase by Acinetobacter sp 9, Bacillus thuringiensis, and Enterobacter sp was observed at 48 hours. Bacillus cereus strain HYM88 had maximum exoglucanase production at 72 hours. The highest endoglucanase production was observed at 72 hours for all the bacterial isolates except for Enterobacter sp which had maximum production at 48 hours. The trend for the enzyme production over time is shown in Figures 3a and 3b.


3.3.2. Optimum pH for Cellulase Activity

Exoglucanases and endoglucanases produced by Enterobacter sp and Acinetobacter sp 9 showed optimum activities at pH 5. Bacillus cereus strain HYM88 and Bacillus thurengensis exoglucanase showed maximum activity at pH 5 with a clear decline in activity at pH 7 for all the bacterial isolates. The trend of enzyme activities with change in pH is shown in Figures 4a, 4b, and 4c.


3.3.3. Optimum Temperature for Cellulase Activity

The optimum temperature of enzyme activities of the bacterial isolates was found to be 50 °C for exoglucanase, endoglucanase, and total cellulases. The endoglucanase activity of Bacillus cereus strain HYM88 dropped by 21.2 % at temperature increase from 50°C to 55°C (Figure 5b). The profiles of the activities of the cellulases are shown in Figures 5a, b, and c.


3.3.4. Diversity of Cellulases Produced by the Selected Bacterial Isolates

All bacterial isolates were able to produce exoglucanases, endoglucanases, and total cellulases (Figure 6). All the bacterial isolates had much higher (more than 80 %) exoglucanase activity than endoglucanase activity. Acinetobacter sp 9 had the highest endoglucanase activity of 0.015 U/m. Enterobacter sp had the highest exoglucanase activity of 0.11035 U/ml.

3.4. Discussion

The number of bacteria isolated from the Victoria Falls rain forest decaying logs compound sample (8.1 Х 10 6 cfu/g of sample) was slightly higher than bacterial counts found in similar research reported by Goyari et al. 22 who obtained 3.35 Х 10 ⁶cfu/g bacteria on cellulase selective media from a soil sample rich in decaying organic matter collected from forest floors of North East India. The abundance of bacteria isolated from the Victoria Falls decaying logs compound sample indicates its potential to unfold valuable cellulase-producing bacteria.

Of the bacterial isolates selected as being cellulase producers, two were Gram-positive rods (Bacillus cereus strain HYM88 and Bacillus thuringiensis).This finding is in line with literature as several researchers have isolated Gram-positive cellulase-producing bacteria. Behera and colleagues 23 isolated eight Gram-positive cellulase-producing bacteria out of a total of 15 bacterial strains isolated from a soil sample. For the genus Bacillus which is a mesophilic aerobic bacteria; the soil offers an ideal habitat. The surface horizons of the soil have abundant oxygen and mild temperatures (25-35°C) which are suitable for mesophilic aerobic bacteria. Furthermore, the soil has dead plant material which is the carbon source 24.

Lower frequencies of Gram-negative cellulase-producing bacteria have also been isolated. In this study, the isolated Gram-negative cellulase-producing bacterial isolates were Enterobacter sp and Acinetobacter sp 9.

Temperature and pH are essential parameters for cellulase activity 25. The optimum temperature for cellulase activity varied amongst the cellulases from the different bacterial isolates. Regarding the optimum temperature of cellulase activity (50 to 55 °C), the findings of this research are similar to those reported by Sadhu and colleagues 26, which had optimum temperatures of cellulases produced by bacteria ranging from 50 °C to 60 °C. Farinas and collaborators 27 stated that the optimum temperature for cellulases ranges between 40 °C and 50 °C. This implies that the bacterial isolates in this study have an advantage of higher optimum temperature of activity and can be applied in industry with ease.

The maximum pH for enzyme activity of the cellulases produced by all the bacterial isolates was pH 5 with significant activity observed at pH 6 for Bacillus cereus strain HYM88. Exoglucanase activity of the crude enzymes from all the bacterial isolates remained high up to pH 7. Most fungal cellulases are active under acidic conditions 12. Activity of the bacterial isolates at pH 7 means that the cellulases may be applied in industries that require neutral pH for their processes.

In terms of the diversity of cellulases, all the bacterial isolates produced both endoglucanase and exoglucanases. The exoglucanase activities of all the bacterial isolates were much higher than the endoglucanase activities. The fact that the bacterial isolates produce the complete cellulase system and can hydrolyze crystalline cellulose means that they are true cellulolytic bacteria 26. Bacteria that produce only endoglucanases and β glucosidases but not the complete enzyme system are called pseudo cellulolytic and may have picked up genes encoding these enzymes from true cellulolytic bacteria by horizontal transfer. It is the true cellulolytic bacteria that are most applicable in processes such as bioethanol production. This is because the complete hydrolysis of cellulose requires the synergistic action of exoglucanases and endoglucanases 28. Endoglucanases initiate degradation creating new ends for which the exoglucanase releases cellobiose or glucose 28.

4. Conclusion

The abundance of decaying logs and other plant biomass on the Victoria Falls rainforest floors indicates the presence of an active cellulolytic microbial community. This was confirmed by the number of bacteria (8.1 Х 10 6 cfu/g of the sample) isolated from the compound sample on Mandel's media. The research has shown that the rainforest could be an ideal site for bioprospecting for cellulases. The cellulase-producing bacteria produced an acceptable cellulase complement in submerged fermentation. The bacterial isolates may be used without modification as bio-inoculants incorporated to enhance organic matter decomposition in the soil to increase soil fertility and minimize the use of fertilizer 4. It is recommended that further studies on the microbial ecology of the Victoria Falls rainforest floors should be carried out to include bioprospecting for non-culturable microorganisms as well as novel microorganisms.

References

[1]  Acharya, S. and Chaudhary, A. (2012).Bioprospecting thermophiles for cellulase production: a review. Brazilian Journal of Microbiology 3: 844-856.
In article      View Article  PubMed
 
[2]  Lee, RL., Weimer, P.J., Willem, H.and Pretorius, I.S.(2002). Microbial Cellulose Utilization: Fundamentals and Biotechnology. Microbiology and Molecular Biology Reviews 3:506-577.
In article      View Article  PubMed
 
[3]  Wyman, C.E., Dale, B.E., Elander, R.T., Hotzapple, M., Ladisch, M.R. and Lee, Y.Y. (2005). Coordinated development of leading biomass pre-treatment technologies. Bioresource Technology 96:1959-1966.
In article      View Article  PubMed
 
[4]  Li, X., Hua-jun, Y., Bhaskar, R., Dan, W., Wan-fu, Y., Li-jun, J., Enoch, Y. and Yun-gen, M. (2009). The most stirring technology in the future; cellulase enzyme and biomass utilization. African Journal of Biotechnology 8: 2418-2422.
In article      
 
[5]  Sukumaran, K.R., Singhania, R.R. and Pandey, A. (2005). Microbial cellulases- Production, applications, and challenges. Journal of Scientific and Industrial Research 64: 832-844.
In article      
 
[6]  Monserrate, E., Leschine, S.B. and Canale-Parola, E. (2001).Clostridium hungatei a mesophillic, N2-fixing cellulolytic bacterium isolated from soil. Evolution and Microbiology 51: 123-132.
In article      View Article  PubMed
 
[7]  Mrudula, S. and Murugammal, R. (2011). Production of cellulase by Aspergillus niger under submerged and solid-state fermentation using coir waste as a substrate. Brazilian Journal of Microbiology, 42: 1119-1127.
In article      View Article  PubMed
 
[8]  Sreedevi, S., Sreedharan, S. and Sailas, B. (2013). Cellulase-producing bacteria from the wood yards on Kallai River Bank. Advances in Microbiology 3: 326-332.
In article      View Article
 
[9]  Maki, M., Kam, T. and Wensheng, Q. (2009). The prospects of cellulase-producing bacteria for the bioconversion of lignocellulosic biomass. International Journal of Biological Sciences 5: 500-510.
In article      View Article  PubMed
 
[10]  Kellner, H., Vandenbol, M. (2010). Fungi unearthed: transcripts encoding lignocellulolytic and chitinolytic enzymes in forest soil. Public Library of Science 6:109-115.
In article      View Article  PubMed
 
[11]  https://whc.unesco.org/en/list/509 [Accessed Aug. 20, 2021].
In article      
 
[12]  Acharya, P. B., Acharya, D.K. and Modi, H.A. (2008). Optimization for cellulase production by Aspergillus niger using sawdust as substrate. African Journal of Biotechnology 7: 4147-4152.
In article      
 
[13]  Kasana, R.C., Richa, S., Dhar, H., Dutt, S. and Gulati, A. (2008). A rapid and easy method for the detection of microbial cellulases on agar plates using Gram’s iodine. Current Microbiology 5:503-507.
In article      View Article  PubMed
 
[14]  Sambrook, J., Fritch, E.F. and Maniatis T. (1989) Molecular Cloning. A Laboratory Manual 2nd Ed. Cold Spring Harbor, New York.
In article      
 
[15]  Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J. (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of Bacteriology 173(2): 697-703.
In article      View Article  PubMed
 
[16]  Liang, Y., Zhang, Z., Wu, M. and Feng, J. (2014). Isolation, Screening, and Identification of Cellulolytic Bacteria from Natural Reserves in the Subtropical Region of China and Optimization of Cellulase Production by Paenibacillus terrae ME27-1. BioMedical Research International. 5(7), 144-149.
In article      View Article  PubMed
 
[17]  Sethi, S., Aparna, D.B., Gupta, L. and Gupta, S. (2013). Optimization of Cellulase Production from Bacteria Isolated from Soil. International Scholarly Research Notices.
In article      View Article  PubMed
 
[18]  Miller, G.N. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 3: 426–428.
In article      View Article
 
[19]  King, B.C., Donnelly, M.K., Bergstrom, G.C., Walker, L.P. and Gibson, D.M. (2009). An optimized micro-plate assay system for quantitative evaluation of plant cell wall degrading enzyme activity of fungal culture extracts. Biotechnology and Bio-engineering 102: 1033-1044.
In article      View Article  PubMed
 
[20]  Xiao, Z., Storms, R. and Tsang, A. (2004). Microplate-Based Filter Paper Assay to Measure Total Cellulase Activity. Biotechnology and Bioengeneering 7: 832-837.
In article      View Article  PubMed
 
[21]  Quiroz-Castaneda, R.E., Balcazar-Lopez, E., Dantan-Gonzalez, E., Martinez, A., Folch-Mallol, J. and Martinez Anaya, C. (2009).Characterization of cellulolytic activities of Bjerkandera adusta and Pycnoporus sanguineuson solid wheat straw medium. Electronic Journal of Biotechnology 12 (4): 1-8.
In article      View Article
 
[22]  Goyari, S., Shantibala, S. D., Mohan, C. K. and Talukudar, N. C.. (2014). Population, diversity, and characteristics of cellulolytic microorganisms from the Indo-Burma Biodiversity hotspot.Springer Plus 3 (1): 700.
In article      View Article  PubMed
 
[23]  Behera, B., Parida, S., Dutta, S. and Thatoi, H. (2014). Isolation and identification of cellulose-degrading bacteria from mangrove soil of Mahanadi River Delta and their cellulase production ability. American Journal of Microbiological Research, 2: 41-46.
In article      View Article
 
[24]  Jansen, P.H. (2006). Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Applied and Environmental Microbiology 3: 1719-1728.
In article      View Article  PubMed
 
[25]  Bai, S., Ravi, M., Mukesh, P., Kumar, D.J., Balashanmugam, P. and Bala, M. D. (2012). Cellulase Production by Bacillus subtilis isolated from Cow Dung. Archives of Applied Science Research 4: 269-279.
In article      
 
[26]  Sadhu, S., and Maiti, T. K. (2013). Cellulase Production by Bacteria: A Review British Microbiology Research Journal. 3:235-258.
In article      View Article
 
[27]  Farinas, C., Loyo, M.M., Baraldo, A. and Couri, S. (2010). Finding stable cellulase and xylanase: Evaluation of the synergistic effect of pH and temperature. New Biotechnology. 27: 810-815.
In article      View Article  PubMed
 
[28]  Kumar, R., Sing, S., Singh, O.V. (2008). Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives. Journal of Industrial Microbiology and Biotechnology 35: 377-391.
In article      View Article  PubMed
 

Published with license by Science and Education Publishing, Copyright © 2023 Makhosazana Nyathi, Zephaniah Dhlamini and Thembekile Ncube

Creative CommonsThis work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Cite this article:

Normal Style
Makhosazana Nyathi, Zephaniah Dhlamini, Thembekile Ncube. Bioprospecting for Cellulase-Producing Bacteria from Victoria Falls Rainforest Decaying Logs. American Journal of Microbiological Research. Vol. 11, No. 3, 2023, pp 73-78. http://pubs.sciepub.com/ajmr/11/3/2
MLA Style
Nyathi, Makhosazana, Zephaniah Dhlamini, and Thembekile Ncube. "Bioprospecting for Cellulase-Producing Bacteria from Victoria Falls Rainforest Decaying Logs." American Journal of Microbiological Research 11.3 (2023): 73-78.
APA Style
Nyathi, M. , Dhlamini, Z. , & Ncube, T. (2023). Bioprospecting for Cellulase-Producing Bacteria from Victoria Falls Rainforest Decaying Logs. American Journal of Microbiological Research, 11(3), 73-78.
Chicago Style
Nyathi, Makhosazana, Zephaniah Dhlamini, and Thembekile Ncube. "Bioprospecting for Cellulase-Producing Bacteria from Victoria Falls Rainforest Decaying Logs." American Journal of Microbiological Research 11, no. 3 (2023): 73-78.
Share
  • Figure 1. The four bacterial isolates (a) Enterobacter sp, (b) Acinetobacter sp 9, (c) Bacillus cereus strain HYM88 and (d) Bacillus thurengensis drop inoculated on Mandel's media agar plates for measurement of clearance zones. The zone of clearance was measured in millimeters from the edge of the colony to the end of the clearance zone.
  • Figure 2. Gel electrophoresis of 16S rDNA PCR amplification of the genomic DNA isolated from the selected cellulase-producing bacteria, M is the 100 bp molecular weight marker. Lane 1 is Enterobacter sp, Lane 2 is Bacillus thuringensis, Lane 3 is Acinectobacter sp 9 and Lane is Bacillus cereus strain HYM88.
  • Figure 3. Production of a) exoglucanase, b) endoglucanase by Enterobacter sp (♦), Bacillus cereus strain HYM88 (), Bacillus thurengensis () and Acinetobacter sp 9 (●) over 120 hours at 28 °C. Results are represented as the mean of three samples.
  • Figure 4. Effect of pH on (a) exoglucanase, (b) endoglucanase, and (c) total cellulose activity of crude enzymes produced by Enterobacter sp (♦), Bacillus cereus strain HYM88 (), Bacillus thurengensis (), Acinetobacter sp 9 (●), obtained from 72-hour cultures at 28 °C at pH 4 to 9.
  • Figure 5. Effect of temperature on (a) exoglucanase, (b) endoglucanase, and (c) total cellulase activity produced by Enterobacter sp (♦), Bacillus cereus strain HYM88 (), Bacillus thurengensis (), Acinetobacter Pitti (●), carried temperatures ranging from 45 °C to 70 °C at pH 5.
  • Figure 6. Diverse cellulases produced by the bacterial isolates as indicated by exoglucanase (■), endoglucanase (■), and total cellulase (■) activities. Results are represented as the mean of three samples.
[1]  Acharya, S. and Chaudhary, A. (2012).Bioprospecting thermophiles for cellulase production: a review. Brazilian Journal of Microbiology 3: 844-856.
In article      View Article  PubMed
 
[2]  Lee, RL., Weimer, P.J., Willem, H.and Pretorius, I.S.(2002). Microbial Cellulose Utilization: Fundamentals and Biotechnology. Microbiology and Molecular Biology Reviews 3:506-577.
In article      View Article  PubMed
 
[3]  Wyman, C.E., Dale, B.E., Elander, R.T., Hotzapple, M., Ladisch, M.R. and Lee, Y.Y. (2005). Coordinated development of leading biomass pre-treatment technologies. Bioresource Technology 96:1959-1966.
In article      View Article  PubMed
 
[4]  Li, X., Hua-jun, Y., Bhaskar, R., Dan, W., Wan-fu, Y., Li-jun, J., Enoch, Y. and Yun-gen, M. (2009). The most stirring technology in the future; cellulase enzyme and biomass utilization. African Journal of Biotechnology 8: 2418-2422.
In article      
 
[5]  Sukumaran, K.R., Singhania, R.R. and Pandey, A. (2005). Microbial cellulases- Production, applications, and challenges. Journal of Scientific and Industrial Research 64: 832-844.
In article      
 
[6]  Monserrate, E., Leschine, S.B. and Canale-Parola, E. (2001).Clostridium hungatei a mesophillic, N2-fixing cellulolytic bacterium isolated from soil. Evolution and Microbiology 51: 123-132.
In article      View Article  PubMed
 
[7]  Mrudula, S. and Murugammal, R. (2011). Production of cellulase by Aspergillus niger under submerged and solid-state fermentation using coir waste as a substrate. Brazilian Journal of Microbiology, 42: 1119-1127.
In article      View Article  PubMed
 
[8]  Sreedevi, S., Sreedharan, S. and Sailas, B. (2013). Cellulase-producing bacteria from the wood yards on Kallai River Bank. Advances in Microbiology 3: 326-332.
In article      View Article
 
[9]  Maki, M., Kam, T. and Wensheng, Q. (2009). The prospects of cellulase-producing bacteria for the bioconversion of lignocellulosic biomass. International Journal of Biological Sciences 5: 500-510.
In article      View Article  PubMed
 
[10]  Kellner, H., Vandenbol, M. (2010). Fungi unearthed: transcripts encoding lignocellulolytic and chitinolytic enzymes in forest soil. Public Library of Science 6:109-115.
In article      View Article  PubMed
 
[11]  https://whc.unesco.org/en/list/509 [Accessed Aug. 20, 2021].
In article      
 
[12]  Acharya, P. B., Acharya, D.K. and Modi, H.A. (2008). Optimization for cellulase production by Aspergillus niger using sawdust as substrate. African Journal of Biotechnology 7: 4147-4152.
In article      
 
[13]  Kasana, R.C., Richa, S., Dhar, H., Dutt, S. and Gulati, A. (2008). A rapid and easy method for the detection of microbial cellulases on agar plates using Gram’s iodine. Current Microbiology 5:503-507.
In article      View Article  PubMed
 
[14]  Sambrook, J., Fritch, E.F. and Maniatis T. (1989) Molecular Cloning. A Laboratory Manual 2nd Ed. Cold Spring Harbor, New York.
In article      
 
[15]  Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J. (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of Bacteriology 173(2): 697-703.
In article      View Article  PubMed
 
[16]  Liang, Y., Zhang, Z., Wu, M. and Feng, J. (2014). Isolation, Screening, and Identification of Cellulolytic Bacteria from Natural Reserves in the Subtropical Region of China and Optimization of Cellulase Production by Paenibacillus terrae ME27-1. BioMedical Research International. 5(7), 144-149.
In article      View Article  PubMed
 
[17]  Sethi, S., Aparna, D.B., Gupta, L. and Gupta, S. (2013). Optimization of Cellulase Production from Bacteria Isolated from Soil. International Scholarly Research Notices.
In article      View Article  PubMed
 
[18]  Miller, G.N. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 3: 426–428.
In article      View Article
 
[19]  King, B.C., Donnelly, M.K., Bergstrom, G.C., Walker, L.P. and Gibson, D.M. (2009). An optimized micro-plate assay system for quantitative evaluation of plant cell wall degrading enzyme activity of fungal culture extracts. Biotechnology and Bio-engineering 102: 1033-1044.
In article      View Article  PubMed
 
[20]  Xiao, Z., Storms, R. and Tsang, A. (2004). Microplate-Based Filter Paper Assay to Measure Total Cellulase Activity. Biotechnology and Bioengeneering 7: 832-837.
In article      View Article  PubMed
 
[21]  Quiroz-Castaneda, R.E., Balcazar-Lopez, E., Dantan-Gonzalez, E., Martinez, A., Folch-Mallol, J. and Martinez Anaya, C. (2009).Characterization of cellulolytic activities of Bjerkandera adusta and Pycnoporus sanguineuson solid wheat straw medium. Electronic Journal of Biotechnology 12 (4): 1-8.
In article      View Article
 
[22]  Goyari, S., Shantibala, S. D., Mohan, C. K. and Talukudar, N. C.. (2014). Population, diversity, and characteristics of cellulolytic microorganisms from the Indo-Burma Biodiversity hotspot.Springer Plus 3 (1): 700.
In article      View Article  PubMed
 
[23]  Behera, B., Parida, S., Dutta, S. and Thatoi, H. (2014). Isolation and identification of cellulose-degrading bacteria from mangrove soil of Mahanadi River Delta and their cellulase production ability. American Journal of Microbiological Research, 2: 41-46.
In article      View Article
 
[24]  Jansen, P.H. (2006). Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Applied and Environmental Microbiology 3: 1719-1728.
In article      View Article  PubMed
 
[25]  Bai, S., Ravi, M., Mukesh, P., Kumar, D.J., Balashanmugam, P. and Bala, M. D. (2012). Cellulase Production by Bacillus subtilis isolated from Cow Dung. Archives of Applied Science Research 4: 269-279.
In article      
 
[26]  Sadhu, S., and Maiti, T. K. (2013). Cellulase Production by Bacteria: A Review British Microbiology Research Journal. 3:235-258.
In article      View Article
 
[27]  Farinas, C., Loyo, M.M., Baraldo, A. and Couri, S. (2010). Finding stable cellulase and xylanase: Evaluation of the synergistic effect of pH and temperature. New Biotechnology. 27: 810-815.
In article      View Article  PubMed
 
[28]  Kumar, R., Sing, S., Singh, O.V. (2008). Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives. Journal of Industrial Microbiology and Biotechnology 35: 377-391.
In article      View Article  PubMed