Article Versions
Export Article
Cite this article
  • Normal Style
  • MLA Style
  • APA Style
  • Chicago Style
Original Article
Open Access Peer-reviewed

Validity of Cefoxitin Disc Diffusion Test for the Detection of Methicillin-resistant Staphylococcus Aureus

Hafiza Sultana , Jogendra Nath Sarker, Md. Abdullah Yusuf, Md. Tofael Hossain Bhuiyan, Md. Mostaqimur Rahman, Shirin Tarafder
American Journal of Infectious Diseases and Microbiology. 2018, 6(1), 26-29. DOI: 10.12691/ajidm-6-1-4
Published online: March 19, 2018

Abstract

Definite detection of MRSA is important for proper treatment. The purpose of the present study was to measure the validity of cefoxitin disc diffusion test for the detection of methicillin-resistant Staphylococcus aureus. This cross-sectional study was carried out in the Department of Microbiology and Immunology at Bangabandhu Sheikh Mujib Medical University, Dhaka from January 2010 to December 2010 for a period of one (01) year. S. aureus isolates were collected from different clinical samples including wound swab, pus, blood, urine, tracheal aspirate, throat swab, aural swab etc. Staphylococcus aureus (S.aureus) were isolated and confirmed by staining, biochemical tests. Routine antimicrobial susceptibility testing was performed cefoxitin discs diffusion test. PCR was performed for detection of the mecA gene for MRSA. Out of the 22 suspected MRSA isolates 19 were mecA positive by PCR and all of them 19(100.0%) were resistant to cefoxitin disc diffusion. The comparison of oxacillin and cefoxitin resistance and presence of mecA gene by PCR showed that out of 22 suspected MRSA isolates 19 were mecA positive by PCR and all the 19 (100.0%) showed resistance to cefoxitin disc diffusion. The sensitivity and specificity of cefoxitin disc diffusion were 100.0% and 100.0% respectively. Cefoxitin disc diffusion test has high sensitivity and specificity for the detection of MRSA.

1. Introduction

Antibiotic resistant pathogens constitute an important and growing threat to the public health1. Antibiotic resistance occurs when a microbe acquires a gene or alters its structural components, which allows the microbe to inactivate the antibiotic or nullify its antimicrobial activity2. This may occur as a spontaneous, genetic mutation or involve acquisition of a genetic element such as plasmid, transposon, integron or gene cassette3.

Emergence of MRSA poses threat to most of the available antibiotic classes and limits the therapeutic options4. Therefore, quick and reliable identification procedure is required to obtain information on the MRSA isolates5. This measure also allows faster implementation of appropriate control measures. Oxacillin disc diffusion test shows abnormalities for the detection of MRSA6-8. Therefore, the present study was undertaken to detect the MRSA by cefoxitin disc diffusion method and to compare with PCR for the detection of mecA gene for MRSA.

2. Methodology

This cross-sectional study was performed in the Department of Microbiology and Immunology at Bangabandhu Sheikh Mujib Medical University, Dhaka from January 2010 to December 2010 for a period of 12 months. Different clinical samples were collected from the patients at any age with both sexes like wound swab, pus, blood, urine, tracheal aspirate, throat swab, sputum, aural swab, nasal swab, high vaginal swab, burn swab, drain fluid and fluid from pleural effusion. All specimens were collected aseptically from three hospitals, namely Bangabandhu Sheikh Mujib Medical University (BSMMU), Dhaka Medical College Hospital (DMCH) and a private diagnostic center, Dhaka and inoculated into appropriate media, incubated aerobically at 370 C for 24 hours and colonies identified for Staphylococcus and were confirmed by Gram staining, colony morphology, haemolytic status, pigment production, mannitol fermentation test, motility test (MIU) and other relevant biochemical tests, catalase test, coagulase test both slide and tube test as per standard methods9. In this study, screening for MRSA was done by oxacillin (Oxoid, Canada) and cefoxitin (Oxoid, Canada) disc diffusion methods6. Inhibition zone diameter of cefoxitin was 19 mm reported as resistant10. Conventional PCR was performed to detect mecA gene of 22 suspected S. aureus strains resistant to cefoxitin by disc diffusion at the Molecular Laboratory in the Department of Microbiology and National Forensic DNA Profiling Laboratory of Dhaka Medical College, Dhaka. Methicillin-resistant S. aureus (MRSA) strain [ATCC 43300] were used as positive control. PCR for mecA gene detection were performed by formation of bacterial pellet, DNA extraction, preparation of reaction mixture (25µl) and running in thermo cycler. Primers used for detection of the mecA gene producing a 309-bp amplicon were as follows:

mecA1-F- 5´ TGGCTATCGTGTCACAATCG 3´ (positions 885 to 905) and

mecA2-R- 5´ CTGGAACTTGTTGAGCAGAG 3´ (positions 1174 to 1194)

PCR reactions were performed in a thermocycler under the following conditions: initial denaturation for 10 minutes at 94°C followed by 30 cycles at 94°C for 1 minute, at 54°C for 1 minute, then at 72°C for 1 minute. Final extension was for 7 minutes at 72°C. Mixed the amplicon and ladder with dye (4-5:1 ratio). Then pipetting and dispensing were done onto the wells on gel made by comb. Start the gel electrophoresis at 100 volts for 60 minutes until the end of the reaction indicated by orange color advancement was over. Ethidium bromide (7.5µl) mixed with distilled water (100 ml). Gel was placed in this mixture for 30 minutes staining. Again, de-staining was done in pure water for 20 minutes. The de-stained gel was then placed on UV transilluminator and observed for the presence of DNA bands. Gels were visualized and photographed under ultraviolet illumination. Precautions were taken to prevent the samples from being contaminated by each other or by the skin of laboratory personnel.

3. Results

A total of 120 Staphylococcus aureus (S. aureus) isolates were collected from 266 specimens from three different hospitals.

Of total 120 S. aureus isolates 56(46.7%) isolates were belonged to male and 64 (53.3%) female patients. The data of the current study showed the highest percentage of S. aureus infection was in patients with age group 21 to 30 years next of which 31 to 40 years of age group. It also shows the age group distribution of patients having MRSA infection (Table 1).

Suspected MRSA isolates were detected by phenotypic and genotypic methods. Out of 22 suspected cases 17 (77.3%) were detected by oxacillin disc diffusion while it was 19(86.4%) by both cefoxitin disc diffusion and PCR for mecA gene (Table 2).

The comparison of oxacillin and cefoxitin resistance and presence of mecA gene by PCR showed that out of 22 suspected MRSA isolates 19 were mecA positive by PCR which was ‘gold standard’ and all the 19 (100.0%) showed resistance to cefoxitin disc diffusion (Table 3).

The sensitivity and specificity of cefoxitin disc diffusion were 100.0% and 100.0% respectively (Table 4).

4. Discussion

Currently available phenotypic method for the detection of methicillin resistance in S. aureus is problematic because of the heterogeneous resistance displayed by many clinical isolates11. To overcome this problem many phenotypic and genotypic method have been used. Genotypic based methods for detecting MRSA are more accurate than susceptibility testing while PCR is considered as gold standard assay for detection of MRSA3,6. However, PCR is time consuming and expensive method12. Furthermore, it is not available in most of the routine laboratories; besides, its application, maintenance and reproducibility seem to be difficult because of its complicated procedure and skill needed. Thus, the present study was undertaken to evaluate the efficacy of cefoxitin disc diffusion test to detect MRSA and detection of mecA gene by PCR.

A total of 120 S. aureus were isolated from 266 clinical specimens of which 80(66.7%) isolated bacteria were collected after prior confirmation from the department of Microbiology & Immunology laboratory of Bangabandhu Sheikh Mujib Medical University (BSMMU), 10(8.3%) isolates from Dhaka Medical College Hospital (DMCH) and rest 30(25.0%) isolates were collected from private diagnostic center, Dhaka to get a more representative picture. These isolates were subjected to antimicrobial susceptibility testing by oxacillin and cefoxitin and PCR for detection of the mecA gene. The rate of MRSA infection in different age group in comparison to MSSA infection found that, MRSA infection rate increased gradually with age. It was highest in age group 61-70 years (30%) and next of which 51-60 years (23.1%) where as in the age group 0 to 10 years and 11 to 20 years the MRSA rate was 0%, This result is in conformity with the reports of Khurram et al13 from Pakistan, Lepelletier et al14 from France and from Brazil Sadoyama and Filho15. They reported that MRSA infection was significantly higher in older patients, it may be because old people are more exposed to antimicrobial agents, which lead to selective antibiotic pressure and development of infection with resistant strains and in addition to that declining immunity in old age increases the risk of infection with MRSA strain which might be the reason for high incidences of MRSA infection in elderly.

In this study, suspected MRSA by phenotypic methods was 22 isolates. Of these suspected cases 17(77.3%) were detected by oxacillin disc diffusion while it was 19(86.4%) by both cefoxitin disc diffusion and PCR for mecA gene. Methicillin-resistant Staphylococci are heterogeneous in their expression of resistance to β-lactam agents and the test conditions have a major effect on the expression and therefore the detection of resistance16-20. Conflicting recommendations regarding the most reliable method for routine use are partly related to differences between strains and there may be a variable interaction between the factors affecting the expression of resistance, including the agent tested, the medium, the NaCl concentration, the inoculum, temperature and period of incubation and the reading of endpoints. Borderline resistant strains may have altered PBPs or be penicillinase hyper-producers, and these can be difficult to distinguish from resistant strains that carry the mecA gene16.

In the present study comparison of cefoxitin disc diffusion with oxacillin disc were evaluated for screening of MRSA. Of total 22 suspected isolates 19 were mecA positive by PCR which is gold standard. Out of these 19, 16 (84.2%) were resistant by oxacillin disc diffusion and 3(15.8%) were sensitive, on the cefoxitin disc diffusion all of them were resistant 19(100.0%) isolates. In the present study the sensitivity and specificity of cefoxitin disc diffusion is 100%. Sensitivity and specificity of cefoxitin disc diffusion were reported by Mathew et al17 were 100% and 100% and by Anand et al2 were 100% & 100% in their study which were almost like the present study. Baddour et al6 described several conventional methods to detect MRSA and were compared with polymerase chain reaction (PCR) for detection of mecA gene-positive isolates. Cefoxitin disc diffusion was found to be the most specific.

It seems that susceptibility testing for MRSA by oxacillin should only be treated as a screening test as Zahan et al18 reported 25% MRSA by PCR while it was 37.5% by oxacillin susceptibility testing. Currently introduced Cefoxitin in susceptibility testing looks promising which are studied by Mathew et al17; Anand et al2 showed almost no discrepancy between cefoxitin susceptibility testing and PCR results as that in this present study also. So, it is time to take measures to prevent the spread of MRSA by proper antibiotic policy, preventing nosocomial infection and proper detection and treatment of MRSA cases.

5. Conclusion

In conclusion the result of cefoxitin disc diffusion for the detection of MRSA has shown high sensitivity and specificity similar to mecA gene detection by PCR. Hence, it can be used as an alternative to the technically demanding PCR. During comparison of oxacillin and cefoxitin resistance and presence of mecA gene by PCR majority MRSA isolates are mecA positive by PCR and all are resistance to cefoxitin disc diffusion. Further large scale study should be carried out.

References

[1]  Durenberg RH, Vinc C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 2007; 13: 222-35.
In article      View Article  PubMed 
 
[2]  Anand KB, Agrawal P, Kumar S and Kapila K. Comparison of Cefoxitin disc diffusion test, oxacillin screen agar and PCR for mecA gene for detection of MRSA. Indian J Med Microbiol 2009; 27(1): 27-29.
In article       PubMed 
 
[3]  Muto CA, Jernigan JA, Ostrowsky BE, Richet HM, Jarvis WR and Boyce JM et al. SHEA guideline for preventive nosocomial transmission of multiresistant of strains of Staphylococcus aureus and Enterococcus. Infec Control Hosp Epidemiol 2003; 24: 362-368.
In article       PubMed 
 
[4]  Ercis S, Sancak B, Hascelik G. A comparison of PCR detection of mecA with oxacillin disc susceptibility testing in different media and scepter automated system for both Staphylococcus aureus and coagulase-negative Staphylococci isolates. Indian J Med Microbiol 2008; 26(1): 21-24.
In article      View Article  PubMed 
 
[5]  Hafiz S, Hafiz AN, Ali L, Chughtai AS, Memon B, Ahmed A, et al., Methicillin resistant Staphylococcus aureus: a multicenter study. J Pak Med Assoc 2002; 52: 312-315.
In article       PubMed 
 
[6]  Baddour MM, AbuEIKheir MM, Fatani AJ. Comparison of polymerase chain reaction with phenotypic methods for the detection of Methicillin-Resistant Staphylococcus aureus. Curr Microbiol 2007; 55: 473-479.
In article      View Article  PubMed 
 
[7]  Yusuf MA, Sattar AA, Habib ZH, Roy S. Clinical and Diagnostic Significance of Methicillin-resistant Staphylococcus aureus Infection in Bangladesh: A Systematic Review. British Microbiology Research Journal 2014;4(7):785
In article      View Article 
 
[8]  CDC. Laboratory Detection of Oxacillin/ Methicillin-resistant Staphylococcus aureus. Available at http://www.cdc.gov/ncidod/dhqp .Accessed on 3rd August, 2010; Updated on 2005.
In article      View Article 
 
[9]  Cheesbrough M. District Laboratory Practice in Tropical countries. 2nd edition. Cambridge Univresity Press, Edinburgh, UK; 2000; 137-142.
In article      View Article 
 
[10]  CLSI. 2010. Performance of standards for antimicrobial susceptibility testing. Twentieth informational supplement. M100-S20; 30 (1): 72-85.
In article      
 
[11]  Yusuf MA, Islam KMS, Shamsuzzaman AKM, Ahmed I, Sattar AFMA. Burden of Infection Caused by Methicillin-Resistant Staphylococcus aureus in Bangladesh: a Systematic Review Global Advanced Research Journal of Microbiology 2013; 2(11): 213-223.
In article      
 
[12]  Bukhari SZH. Trends in antimicrobial resistance and occurrence of methicillin resistant Staphylococcus aureus (MRSA): molecular basis and clinical implications. [PhD thesis]. Department of Microbiology, Quaid-i-Azam University, Islamabad, Pakistan; 2006.
In article      
 
[13]  Khurram IM, Khan SA, Khawja AA, Khan R, Khokher SA and Khawar S et al., 2004. Risk factors for clinical infection in patients colonized with methicillin-resistant Staphylococcus aureus (MRSA). J Pak Med Assoc; 54 (8): 408-412.
In article       PubMed 
 
[14]  Lepelletier D, Ferreol S, Villers D, Richet H. Methicillin-resistant Staphylococcus aureus nosocomial infection in ICU: risk factors, morbidity and cost. Pathol Biol 2004; 52 (8): 474-479.
In article      View Article  PubMed 
 
[15]  Sadoyama G, Filho PP. Risk factors for Methicillin-resistant and sensitive Syaphylococcus aureus infection in Brazilian University Hospital. Braz J Infect Dis; 2000;4(3): 135-143.
In article       PubMed 
 
[16]  Afroz S. Detection of MRSA in patients and carriers by evaluating different methods of identification, its typing and susceptibility to vancomycin. M.Phil. thesis. Department of Microbiology, Dhaka Medical College, Dhaka, Bangladesh, 2005.
In article      
 
[17]  Mathew AA, Thomas M, Appalaraju B, Jayalaxmi J. Evaluation and Comparison of tests to detect methicillin-resistant Staphylococcus aureus. Indian J. Pathol. Microbiol 2010; 53(1): 79-82.
In article      View Article  PubMed 
 
[18]  Zahan NA, Hossain MA, Musa AK, Shamsuzzaman AK, Mahamud MC and Mamun AA et al., 2009. PCR for mecA gene of methicillin-resistant Staphylococcus aureus. Mymensingh Medical Journal 2009; 18(1): 21-26.
In article       PubMed 
 

Published with license by Science and Education Publishing, Copyright © 2018 Hafiza Sultana, Jogendra Nath Sarker, Md. Abdullah Yusuf, Md. Tofael Hossain Bhuiyan, Md. Mostaqimur Rahman and Shirin Tarafder

Creative CommonsThis work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Cite this article:

Normal Style
Hafiza Sultana, Jogendra Nath Sarker, Md. Abdullah Yusuf, Md. Tofael Hossain Bhuiyan, Md. Mostaqimur Rahman, Shirin Tarafder. Validity of Cefoxitin Disc Diffusion Test for the Detection of Methicillin-resistant Staphylococcus Aureus. American Journal of Infectious Diseases and Microbiology. Vol. 6, No. 1, 2018, pp 26-29. http://pubs.sciepub.com/ajidm/6/1/4
MLA Style
Sultana, Hafiza, et al. "Validity of Cefoxitin Disc Diffusion Test for the Detection of Methicillin-resistant Staphylococcus Aureus." American Journal of Infectious Diseases and Microbiology 6.1 (2018): 26-29.
APA Style
Sultana, H. , Sarker, J. N. , Yusuf, M. A. , Bhuiyan, M. T. H. , Rahman, M. M. , & Tarafder, S. (2018). Validity of Cefoxitin Disc Diffusion Test for the Detection of Methicillin-resistant Staphylococcus Aureus. American Journal of Infectious Diseases and Microbiology, 6(1), 26-29.
Chicago Style
Sultana, Hafiza, Jogendra Nath Sarker, Md. Abdullah Yusuf, Md. Tofael Hossain Bhuiyan, Md. Mostaqimur Rahman, and Shirin Tarafder. "Validity of Cefoxitin Disc Diffusion Test for the Detection of Methicillin-resistant Staphylococcus Aureus." American Journal of Infectious Diseases and Microbiology 6, no. 1 (2018): 26-29.
Share
[1]  Durenberg RH, Vinc C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 2007; 13: 222-35.
In article      View Article  PubMed 
 
[2]  Anand KB, Agrawal P, Kumar S and Kapila K. Comparison of Cefoxitin disc diffusion test, oxacillin screen agar and PCR for mecA gene for detection of MRSA. Indian J Med Microbiol 2009; 27(1): 27-29.
In article       PubMed 
 
[3]  Muto CA, Jernigan JA, Ostrowsky BE, Richet HM, Jarvis WR and Boyce JM et al. SHEA guideline for preventive nosocomial transmission of multiresistant of strains of Staphylococcus aureus and Enterococcus. Infec Control Hosp Epidemiol 2003; 24: 362-368.
In article       PubMed 
 
[4]  Ercis S, Sancak B, Hascelik G. A comparison of PCR detection of mecA with oxacillin disc susceptibility testing in different media and scepter automated system for both Staphylococcus aureus and coagulase-negative Staphylococci isolates. Indian J Med Microbiol 2008; 26(1): 21-24.
In article      View Article  PubMed 
 
[5]  Hafiz S, Hafiz AN, Ali L, Chughtai AS, Memon B, Ahmed A, et al., Methicillin resistant Staphylococcus aureus: a multicenter study. J Pak Med Assoc 2002; 52: 312-315.
In article       PubMed 
 
[6]  Baddour MM, AbuEIKheir MM, Fatani AJ. Comparison of polymerase chain reaction with phenotypic methods for the detection of Methicillin-Resistant Staphylococcus aureus. Curr Microbiol 2007; 55: 473-479.
In article      View Article  PubMed 
 
[7]  Yusuf MA, Sattar AA, Habib ZH, Roy S. Clinical and Diagnostic Significance of Methicillin-resistant Staphylococcus aureus Infection in Bangladesh: A Systematic Review. British Microbiology Research Journal 2014;4(7):785
In article      View Article 
 
[8]  CDC. Laboratory Detection of Oxacillin/ Methicillin-resistant Staphylococcus aureus. Available at http://www.cdc.gov/ncidod/dhqp .Accessed on 3rd August, 2010; Updated on 2005.
In article      View Article 
 
[9]  Cheesbrough M. District Laboratory Practice in Tropical countries. 2nd edition. Cambridge Univresity Press, Edinburgh, UK; 2000; 137-142.
In article      View Article 
 
[10]  CLSI. 2010. Performance of standards for antimicrobial susceptibility testing. Twentieth informational supplement. M100-S20; 30 (1): 72-85.
In article      
 
[11]  Yusuf MA, Islam KMS, Shamsuzzaman AKM, Ahmed I, Sattar AFMA. Burden of Infection Caused by Methicillin-Resistant Staphylococcus aureus in Bangladesh: a Systematic Review Global Advanced Research Journal of Microbiology 2013; 2(11): 213-223.
In article      
 
[12]  Bukhari SZH. Trends in antimicrobial resistance and occurrence of methicillin resistant Staphylococcus aureus (MRSA): molecular basis and clinical implications. [PhD thesis]. Department of Microbiology, Quaid-i-Azam University, Islamabad, Pakistan; 2006.
In article      
 
[13]  Khurram IM, Khan SA, Khawja AA, Khan R, Khokher SA and Khawar S et al., 2004. Risk factors for clinical infection in patients colonized with methicillin-resistant Staphylococcus aureus (MRSA). J Pak Med Assoc; 54 (8): 408-412.
In article       PubMed 
 
[14]  Lepelletier D, Ferreol S, Villers D, Richet H. Methicillin-resistant Staphylococcus aureus nosocomial infection in ICU: risk factors, morbidity and cost. Pathol Biol 2004; 52 (8): 474-479.
In article      View Article  PubMed 
 
[15]  Sadoyama G, Filho PP. Risk factors for Methicillin-resistant and sensitive Syaphylococcus aureus infection in Brazilian University Hospital. Braz J Infect Dis; 2000;4(3): 135-143.
In article       PubMed 
 
[16]  Afroz S. Detection of MRSA in patients and carriers by evaluating different methods of identification, its typing and susceptibility to vancomycin. M.Phil. thesis. Department of Microbiology, Dhaka Medical College, Dhaka, Bangladesh, 2005.
In article      
 
[17]  Mathew AA, Thomas M, Appalaraju B, Jayalaxmi J. Evaluation and Comparison of tests to detect methicillin-resistant Staphylococcus aureus. Indian J. Pathol. Microbiol 2010; 53(1): 79-82.
In article      View Article  PubMed 
 
[18]  Zahan NA, Hossain MA, Musa AK, Shamsuzzaman AK, Mahamud MC and Mamun AA et al., 2009. PCR for mecA gene of methicillin-resistant Staphylococcus aureus. Mymensingh Medical Journal 2009; 18(1): 21-26.
In article       PubMed