Abstract

Columnaris disease is a serious disease in warm water fish. It is caused by Flavobacterium columnare, a Gram-negative bacterium. In this work, fucoidan was tested for its efficacy in decreasing the mortalities caused by Columnaris disease in Nile tilapia. Consequently, naturally-infected Nile tilapia with Flavobacterium columnare, showing eroded fins, rigid body figure, and ulcerated body surface, was treated with fucoidan (8 gm/kg ration) for 17 days. Flavobacterium columnare infection was confirmed by isolation on selective medium (cytophaga agar), from the skeletal muscle, tails fins, and gills, giving the typical rhizoid shape. It was also confirmed by Flavobacterium columnare specific PCR using selective primers for Flavobacterium columnare 16S ribosomal DNA. Fucoidan caused decreased the mortalities to nil and cured the eroded fins, the ulcerated body surface, and the rigid body figure. Fucoidan also decreased the tissue damage score to reach the normal histological score.

1. Introduction

Fucoidan, is a branched sulphated fucan extracted from brown seaweeds and marine plants, e.g. tangleweed (Lami-naria japonica), wakame (Undaria pinnati da Sporophyll) and limu moui (Cladosiphon okamuranus) ¹. Fucoidan is known for its anti-bacterial, anti-viral, immunostimulatory, and healing stimulating effects ^{2, 3, 4, 5, 6, 7, 8, 9, 10, 11}.

Columnaris disease is caused by Flavobacterium columnare, a Gram-negative bacterium. It was first reported in 1922 and is one of the most frequently occurring diseases in freshwater fish ¹². Common names for Columnaris disease are fin rot, saddleback disease, cottonwool disease, and cotton mouth disease. The disease commonly causes serious cutaneous and gill lestions ^{12, 13, 14}.

In this study, Flavobacterium columnare infected Nile tilapia was treated with fucoidan to test its efficacy on decreasing the escalating mortalities and the evolved cutaneous lesions caused by infection.

2. Material and Methods

Nile tilapia, 40-60 gm body weight, was obtained from a private fish farm at Aldakahleya Governorate, Egypt. They were maintained in aquarium tanks, provided with adequate aeration. Fifty percent of the water was exchanged twice weekly to maintain water quality. The fish were fed twice daily with a commercial diet, 3% of the body weight. The water temperature was maintained at 25°C ± 2 during the rearing period. The experiment was conducted under ‘Guide for the Care and Use of Laboratory Animals’ approved by the Ethics Committee of the Faculty of Veterinary Medicine, Mansoura University.

Nile tilapia fish was maintained in the laboratory aquaria, as a regular procedure for accomplishment of research work. Twenty fish were kept per aquarium. Signs of fin erosions and surface ulcerations appeared on all reared fish in the aquarium, together with gradual incidence of mortalities. Four dead fish were necropsied for gross examination and sample collection, for microbial isolation (from the skeletal muscle, tail fins, and gills) and histopathological examination of the skeletal muscle. The remaining fish was fed a commercial diet containing fucoidan (8 gm/kg diet) for a period of 17 days and was monitored for mortalities and persistence of surface lesions. Seventeen days post fucoidan treatment, samples were collected from treated fish and negative control normal fish (fish that received normal diet).

Collected skeletal muscle samples were preserved in 20% formaldehyde. Samples were processed for haematoxylin and eosin at Histology laboratory, Faculty of Medicine, Mansoura University ¹⁵. Slides were examined using Apex biological microscope, and images were taken using Apex biological microscope and the Apex Minigrab.

Microbial isolation was performed from collected grossly altered surface musculature, tail fins, and gills.

Skeletal muscle, tail fins, and gills were collected with sterile tools and smashed aseptically using sterile phosphate buffered saline (PBS, pH 7.4), until a homogenate was obtained.

Mile and Misra method was adopted for inoculation of the smashed tissue homogenate on bacterial agar ¹⁶. Briefly, the homogenate was serially diluted in PBS, and 20 μl of each dilution was streaked, using the standard methods, on cytophaga agar plate (tryptone 0.05% weight per volume (w/v), yeast extract 0.05% w/v, sodium acetate 0.02% w/v, beef extract 0.02% w/v, and agar 0.9% w/v ¹⁷. Plates were incubated at 28C for 24 hours and monitored for bacterial growth.

A streak of the bacterial growth was suspeneded in Cytophaga broth and incubated at 28C for 24 hours. A volume of 50 μl of the resulting bacterial growth was suspended in 100 μl (Tris-EDTA) TE buffer, and boiled for 5 min. five μl were used in PCR reaction using Flavobacterium columnare 16S ribosomal DNA specific primers with a resulting 250 bp product ¹², Flavobacterium columnare forward primer: CGATGGGTAGGGGTCCTGAG (metabion, Germany) and Flavobacterium columnare reverse primer: GCTGCTGGCACGGAGTTAGC (metabion, Germany). Basically, the 20 μl PCR reaction consisted of 10μl pf PCR mastermix (iNtTRON Biotechnology, Korea), 1 μl (10 pmol) of each primer (forward or reverse), 2 μl of sample DNA and up to 20 μl nuclease-free water. The thermal cycling included 1 cycle of 12 min at 94°C, 40 cycles of 30 sec at 94ºC, 60 sec at 60ºC, 60 sec at 72°C, followed by 1 cycle of 7 min at 72ºC. PCR products were resolved by electrophoresis using 2% agarose gel (in Tris-Acetate-EDTA (TAE) buffer, Bioshop, Canada). The gel was placed in an electrophoresis tank containing 0.5% TAE and run for 1 h at 80 V. A marker (50 bp ladder, iNtTRON Biotechnology, Korea) was electrophoresed beside the DNA samples to measure the size of the DNA fragments. The DNA fragments were then visualised on a UV transilluminator using long wavelength ultraviolet light.

A tissue damage score was used to evaluate the efficacy of fucoidan treatment as an antibacterial agent and healing stimulator against muscular damage induced by Flavobacterium columnare in Nile tilapia, using a scoring system established in this study, depending on what was previously established ¹⁸, and described in details for the examined organ (skeletal muscle) in Table 1.

Statistical analysis of tissue damage scoring data was performed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test for pairwise comparison, comparing each experimental group to the control one and to every other group in the experimental model, using Graphpad prism software.

3. Results

Following 24h of incubation on the selective medium (cytophaga agar), isolation of Flavobacterium columnare was confirmed by its microbial growth on the selective medium, where colonies on were flat, rhizoid, strongly adherent, and spread across solid media surfaces forming irregular margins Figure 1.

Furthermore, Flavobacterium columnare detection was confirmed by PCR (in the muscle, tail fins, and gills) using Flavobacterium columnare 16S ribosomal DNA specific primers (Figure 2).

Flavobacterium columnare natural infection of Nile tilapia caused fin erosions and surface ulcerations, together with gradual incidence of mortalities (Figure 3). Fucoidan treatment decreased the mortalities to naught and cured the eroded fins, the ulcerated body surface, and the rigid body figure (Figure 3).

Flavobacterium columnare infected muscles showed partial or complete myomalacia, muscular hyaline degeneration, intermuscular oedema, intermuscular leukocytic infiltration, and haemorrhage (Figure 4).

Using the established tissue damage scoring (Table 1), fucoidan treatment of infected Nile tilapia with Columnaris disease cause complete healing of altered musculature (Figure 5).

4. Discussion

In this study, Flavobacterium columnare infected Nile tilapia was treated with fucoidan to test its efficacy on decreasing the escalating mortality rate and the evolved lesions caused by infection. Therefore, naturally-infected Nile tilapia with Flavobacterium columnare was treated with fucoidan (8 gm/kg ration) for 17 days and tested for its effect on decreasing the mortality rate and surface lesions caused by the infection.

Columnaris disease commonly causes serious cutaneous and gill lestions ^{12, 13, 14}. Flavobacterium columnare natural infection (in the muscles, tail fins, and gills of Nile tilapia) was confirmed by its isolation on selective medium (cytophaga agar), giving the typical rhizoid shape. It was also confirmed by Flavobacterium columnare specific PCR using selective primers for Flavobacterium columnare 16S ribosomal DNA ¹².

Fucoidan treatment decreased the mortalities to 0% and cured the eroded fins, the ulcerated body surface, and the rigid body figure. Fucoidan also decreased the tissue damage score to reach the normal histological score. Therefore, this study demonstrated apparent anti-bacterial and cutaneous wound healing effects of fucoidan. Fucoidan is known for its anti-bacterial, anti-viral, immunostimulatory, and healing stimulating effects ^{2, 3, 4, 5, 6, 7, 8, 9, 10, 11}. In a previous study, fucoidan inhibited the growth of Staphylococcus aureus and Escherichia coli ⁵. Fucoidan was also used as a prevention and treatment measure to control diseases caused by Helicobacter pylori ⁴. Similutaneously, previous liteature demonstrated the cutaneous wound healing effect of fucoidan ^{10, 11}.

5. Conclusion

In a natural model of Columnaris disease in Nile tilapia, fucoidan treatment could decrease the resulting mortalities from infection and improved the apparent cutaneous and fins health and general body figure elasticity.

Conflict of Interest

The author declares no conflict of interest.

Acknowledgements

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

References