Abstract

Background: TNFα is an important cytokine in celiac disease which causes the destruction of the intestinal tissue. It has been shown that polymorphisms in the promoter region of the TNFα gene increase its expression. In this study we investigated the -1031 C/T and -376 G/A gene polymorphisms of TNFα gene and also its serum level in Iranian celiac patients compared to healthy controls. Methods: In this cross sectional study, 104 newly diagnosed celiac disease and 102 healthy control were recruited during 2016. The DNA was extracted from peripheral blood. Specific primer pairs were designed and TNFα polymorphisms was determined by polymerase chain reaction (PCR) amplification followed by restriction fragment length polymorphism (RFLP). For confirmation of finding some samples were randomly sequenced. Also to determine the serum concentration of TNFα the ELISA method was used. Result: The mean age of cases and control was 32, 33 years respectively. No significant difference was observed between CD patients and healthy controls regarding -1031 C / T and -376 G / A gene polymorphisms (for -376 G/A; p= 0.8 and for -1031 C/T; p=0.35 respectively). Also there was no significant difference in serum level of TNFα between celiac patients and healthy subjects (p= 0.18). Conclusion: According to our results, it seems that the TNF-α (-1031 C/T, -376 G/A) gene polymorphisms in combination with serum level may not be associated with the risk of celiac disease.

1. Introduction

Celiac disease as an autoimmune disease caused by the use of special protein called gluten, that is commonly found in wheat, rye and barley, in genetically susceptible individuals ¹. Exposure to gluten leads to several autoantibodies that cause small bowel mucosa abnormality ². Following strict gluten-free diet, intestinal injuries include villous atrophy and crypt hyperplasia, can be improved ³. Although the HLADQ2 and HLADQ8 molecules are known to be the most important genetic factor in celiac disease, but the role of other genetic factors that contribute to the onset of CD disease is highlighted ⁴. TNFα is known as an important cytokine in the pathogenesis of celiac disease ⁵. Investigation showed that, exposure of the mucosa to gluten causes the expression of TNF-α in CD patients ⁶. TNFα plays an important role in damaging the intestinal tissue of patients with celiac disease ⁷. Gliadin, which is derived from gluten digestion in the intestinal wall, is metabolized by the tissue transglutaminase enzyme. In this process, the glutamine roots are replaced by glutamic acid. These parts are attached to the HLADQ2 and HLADQ8 molecules of the APC surface and are provided to CD4+ T cells ⁸. By activating Th1 with CD4+ T cells and secreting TNFα from TH1, the fibroblasts of the intestine is affected by this cytokine, which results increased metalloproteinase secretion and destruction of the intestinal tissue ⁹. Also the TNFα gene is located between the HLA class I and class II genes ¹⁰ and its expression is adjusted at the transcriptional level ¹¹. It has been reported that sequence diversity in the regulatory region of this gene is associated with autoimmune diseases ¹².

In addition, it has been shown that there are several polymorphisms in the promoter region of this cytokine they are effective to increasing its secretion ⁷. A large number of single nucleotide polymorphisms in the upstream region of the TNFα gene are located at -1031 851, -419, -376, -308, -28, -863, -857, -49 and -49 in relation to the initiator region of the translation ¹³. Considering the effect of promoter polymorphisms on the expression of TNFα gene and the role of this cytokine in the pathogenesis of celiac disease, the aim of this study is to determine the association between polymorphisms -376 G>A(rs1800750) and -1031 C>T (rs1799964) in the promoter region of TNFα gene and CD and also its serum level in Iranian population.

2. Material and Methods

In this case- control study, proven celiac disease were enrolled as a patient group using following inclusion criteria: seropositive patients whom were confirmed by histopathological examination. Patients with other autoimmune diseases such as IBD and type 1 diabetes were excluded from study. Also negative celiac disease during endoscopy and serology and without family history of celiac disease were included as control.

Both groups were selected at the age range of 18-70 years without any sexual limitation. Patients have signed the consent form and study was approved by the Ethics Committee of Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Blood samples (10 ml) were collected from both groups, DNA was extracted from PBMC cells using the commercial kit (Invitrogen, USA) according to manufacture instructions. For the two promoter regions -376 G/A (rs1800750) and -1031C/T (rs1799964), the appropriate primer pairs were designed using Gene Runner software. -376 G/A polymorphism was amplified using following primer pairs: forward: ACACAGCTTTTCCCTCCAAC and revers: GGACACACAAGCATCAAGGA and forward: TCTGTCTGGCTGAGGATTTC and reverse: TCTCCTACCCATTGCTGTG primer pairs were used for amplification of -1031 C/T (rs1799964). Proliferation of DNA was performed using the PCR technique (Table 1).

The length of the PCR products for rs1799964 and rs1800750 was 763bp and 292 bp, respectively. The accuracy of the PCR product was confirmed by electrophoresis 1. % agarose gel. 10 µl of The PCR product of -376 G/A (rs1800750) was digested at 37°C for 2 hours with mluc I restriction enzyme (New England Biolabs). 10 µl of The PCR polymorphism-1031C/T product under the action of bbsI enzyme (New England Biolabs) was digested at 37 ° C for 1 hour. The products of the RFLP was analyzed by electrophoresis 3. % agarose gel. The TNFα serum level was also measured using the ELISA kit (Invitrogen by Thermo Fisher Scientific).

We used the SPSS version 18.0 in order to statistical analysis of results. The chi-square (χ²) test was used for the calculation of genotypic and allelic frequency. If P ≤ 0.05 the differences was considered significant.

3. Result

Out of 104 celiac disease patients (mean age 32 years old and mean BMI: 23), 38 (36.5%) were male and 66 (63.5%) were female. Of the 102 healthy individuals (mean age= 33 year old; and mean BMI: 24), 56 (54.9%) were female and 46 (45.1%) were male. Most predominant symptom in case group was anemia (68.3%) followed by bloating (35.6%) and abdominal pain (29.8%) and between control group anemia (84.3%), neurological problems (20.6%) and bloating (20.6%) were more frequent. Demographic and clinical presentation were illustrated in Table 2.

Allele and genotype frequency of rs17799964 and rs1800750 were studied in patients with celiac disease in compared to control group. For rs1800750 polymorphism, three different bands derived from MLUCI digestion including GG (292bp), TG (292bp, 101bp, and 191bp), TT (101bp, 191bp) were observed on electrophoresis gel, but only GG and TG genotypes were detected (Figure 1). There was no a significant correlation between the allele and genotype frequency of the rs1800750 polymorphism and CD compared with the control group (p = 0.82, p=0.8 respectively).

For rs1799964 polymorphism, three different bands including TT (763bp), CC (634bp- 129 bp), CT (763bp-634bp-129bp) were observed on electrophoresis gel using BBSI digestion enzyme. The digested products were separated on 3% gel electrophoresis (Figure 2). Also, no significant correlation was observed between allele and genotype frequency of the rs1799964 polymorphism and CD compared with the control group (p = 0.07, p=0.35 respectively) (Table 3, Table 4).

The association between rs1799964 and rs1800750 SNPs and age, sex, BMI of celiac disease was studied. The results showed no significant difference between rs1800750 and rs1799964 polymorphisms and investigated variables (for rs1800750: p=0.83, p = 0.83 and p = 0.24 respectively and for rs1799964: p = 0.33, p = 0.25 and p = 0.62, respectively).

On the other hands the serum cytokine level of TNFα in both groups was investigated and the results showed that there was no significant difference between the mean serum level of TNFα in patients group (mean= 0.07) compare with the healthy population (mean= 0.07), (p-value= 0.1) (Figure 3).

4. Discussion

Genetic factors play an important role in celiac disease ¹⁴. CD has a strong genetic link with the HLA molecule, but it has been shown that the role of this molecule in the development of the CD is about 40%. Consequently, the function of other genetic compounds is considered in the pathogenesis of CD ⁴. Studies have shown that the HLA gene contains several genetic predisposing factors for CD disease independent of the DQ gene ¹⁵. On of them is TNFα gene that is located between the HLA Class I and Class II region ¹⁶ and as an inflammatory cytokine plays important roles in celiac disease ¹⁷. It has been shown that some polymorphisms in the promoter region of TNFα cause the transcription of the TNFα gene and consequently, of increasing its production ⁷. For these reasons we investigated the allelic and genotype frequencies of -1031 and -376 polymorphisms among healthy and CD patients. Significant differences were not observed between TNFα -1031 and -376 allele and genotype and susceptibility to CD. Also we have not found a relationship between these polymorphisms and age, sex and BMI. These results proposed that TNFα gene does not have relation to celiac disease in our population.

The role of -1031 and -376 TNFα polymorphisms in CD has not yet clearly stated, and because of that it is essential to investigate these polymorphisms in groups of more populations with different ethnic background. -1031 and -376 SNPs have been studied in few celiac papulations studies. In a recent study in 2015 by Rossi et al. they found that C allele of polymorphism -1031 and allele A of polymorphism -376 were associated with celiac disease ¹⁸. The question is why we were not found the same result like what they reported. It could be explained by difference in the prevalence of celiac disease in different parts of the world and due to the fact that different populations have different genotypes. Also our result is may due to low sample size.

These SNPs have been studied in other diseases especially Non-immune diseases and different studies did not find any association between these SNPs and Non-immune diseases. Danfort et al. (2008) did not find association between -1031 C/T polymorphism and risk of prostate cancer ¹⁹. Yang et al. in 2009 in the Korean population showed that TCT and CCC haplotypes of -1031 C / T are significantly associated with the risk of gastric cancer in smokers ²⁰. According to the result from Kuroda et al. no significant correlation was seen between -1031 C/T polymorphism and sarcoidosis in a Japandosis in Japan ²¹.

Th1 secreted cytokines have been shown to be associated with autoimmune diseases ²². TNFα is one of the most important cytokine that releases from Th1 ²³. It has been shown that TNFα, by increasing the activity of metalloproteinases in CD, causes the destruction of the intestinal tissue ¹⁷. In this study also, the serum level of TNFα was investigated among patients and control groups. According to the results, no significant difference was observed between serum TNFα concentration between two groups (P = 0.1). our reports on TNFα level serum was similar to Romaldini et al. that showed no significant difference in serum TNFα concentration in untreated CD, patients under treatment and control group ²⁴. In 2014, Björck et al. also did not find significant difference in serum TNFα concentration of children with CD in comparison with control group ²⁵. Street and colleagues in 2007, reported that concentration of serum TNFα in CD subjects before GFD treatment showed an increase compared with the control group, whereas after treatment for 6 months, the serum TNFα concentration was decreased ²⁶.

In conclusion, we showed that TNFα -1031C/T and -376G/A SNPs are not associated with celiac disease in Iranian population. However, a wider population is needed to confirm these findings.

Acknowledgements

We thank all people who helped us. Research supported by Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Science (Tehran, Iran).

References