Abstract

In Nigeria, increasing cases of food borne diseases especially diarrhea reported by many families has been linked to consumption of microbial contaminated flour based meals. Exposed and packaged cassava, yam and plantain flour are locally available in our markets. In this study, standard microbiological methods were used to isolate and identify bacterial and fungal isolates from the flour samples. Further characterization of the isolates was done using molecular methods. Our results shows that Bacillus sp. (46.67 %), Staphylococcus sp. (40 %), Escherichia coli (10 %) and Salmonella sp. (3.33 %) is the percentage frequency of occurrence of bacterial isolates; Microsporum audouinii (14.08 %), M. canis (2.82 %), M. nanum (5.63 %), Exserohilum sp. (9.86 %), Trichoderma sp. (7.04 %), Candida tropicalis (5.63 %), C. rugosa (9.9 %), C. krusei (2.82 %) C. glabrata (5.63 %), Aspergillus fumigatus (4.23 %), A. flavus (1.41 %), A. terreus (2.83 %), A. versicolor (1.41 %), A. clavatus (2.82 %), A. niger (5.63 %), Phaeoacremonim sp. (1.41 %), Epicoccum sp. (2.82 %), Exophiala dermatitidis (1.41 %), Penicillium sp. (1.41 %), Cokeromyces sp. (2.82 %), Aureobasidium sp. (1.41 %), Rhodotorula sp. (2.82 %), Fonsecaea pedrosoi (1.41 %) and Phoma sp. (2.82 %) are percentage frequency of occurrence of fungal isolates. Molecular characterization revealed the bacterial isolates to be Bacillus megaterium strain WSH10 16S, Enterobacter sp. strain HZ21, Alcaligenes feacalis strain CGAPGPBS and Acinetobacter junii strain SB132 while the fungal isolates are Aspergillus niger strain NI26, Paecilomyces sinensis strain Gr133 and Tramestes polyzona strain CNRMA14.236. It is recommended that edible flours should be produced under strict hygienic condition and packaged to prevent microbial contamination of the products.

1. Introduction

Plantain, cassava and yam are high starchy staple foods consumed by many families in Nigeria. These staples are highly perishable because of its high moisture content which supports microbial spoilage. Therefore, they are usually processed into edible flours which have reduced moisture content and longer shelf life than freshly harvested yam, plantain and cassava. Low moisture content of edible flour is unfavourable to support growth of microorganisms ^{1, 2, 3}.

Cassava, yam and plantain as edible flours have different food applications ^{2, 4, 5}. Apart from its nutritional importance mainly in providing energy to human body, cassava and yam could be beneficial to human health as a result of hypocholesterolemic, antioxidative, hypoglycemic, immunomodulatory and antimicrobial activities of bioactive constituents in the tubers ⁶. In Nigeria, some orthodox and traditional medical personnel recommend plantain flour as a diet that can help diabetic patients manage their health condition ⁷.

Notwithstanding low water activity of yam, cassava and plantain flour, contamination of these edible flours by pathogenic and non-pathogenic microorganisms could occur during processing ^{8, 9}. Unhygienic handling of these edible products and undue expose to environment during retailing also predisposes edible flours to microbial contamination. In Nigerian markets, edible flours especially the ones produced by local farmers are usually exposed during retailing while others produced by cottage industries are usually packaged. Consumption of flour-based products could lead to outbreak of diseases such as diarrhea despite application of heat in the form of baking and cooking at the point where flour is used for food production ^{7, 10}.

In most published works, microbiological quality of edible flours such as cassava, plantain and yam flour were determined using conventional methods ^{9, 11, 12}. Recently, Odu et al. ¹³ carried out a study that investigated the microbiological quality of packaged and exposed cassava, yam and plantain flour sold in markets and supermarkets in Port Harcourt Nigeria. They reported the presence of coliforms, Escherichia coli, Salmonella sp., Staphylococcus sp., Bacillus sp. and fungi in the flour samples. Using conventional method, Odetunde et al. ¹⁴ isolated Flavobacterium sp., Micrococcus sp., Bacillus subtilis, B. polymyxa, B. cereus and Esherichia coli from cassava flour. In a related study, Ajayi ¹⁵ detected Escherichia coli, Klebsiella sp., Bacillus cereus, B. globisporus, B. circulans and Enterococcus spp. in dry plantain flour. Somorin et al. ¹² reported that Bacillus megaterium, Staphylococcus saprophyticus, Fusarium oxysporum, Aspergillus niger and Rhizopus nigricans were present in flour obtained from water yam and white yam. However, their method of identifying microorganisms has its limitations. Molecular identification methods have proven to be more reliable and advantageous than culture-based methods in food safety microbiology ^{16, 17, 18}. So far, there are limited studies that involved molecular methods in identification of potentially pathogenic microorganisms in cassava, plantain and yam flour placed in the markets and supermarkets for public consumption ⁷.

Therefore, this study is aimed at microbiological analysis and the use of molecular methods to identify bacteria and fungi present in exposed and packaged cassava, yam and plantain flour available in some open markets and supermarkets in Port Harcourt metropolis, Rivers State, Nigeria.

2. Materials and Methods

Five edible flour samples each of packaged cassava, yam and plantain flour totaling fifteen (15) samples were obtained from three supermarkets in Port Harcourt, Nigeria. Similarly, fifteen (15) plastic containers already sterilized were used to separately put five samples each of exposed cassava, plantain and yam flour purchased from fifteen retailers in three popular open markets within Port Harcourt metropolis. All the flour samples were taken to Food and Industrial Microbiology Laboratory, University of Port Harcourt where analysis were conducted.

Microbiological analysis of the flour samples were carried out using the methods described by Odu et al. ¹⁹ including that of Eman and Sarifar ²⁰. Presence of Salmonella sp. in the flour samples were ascertained using APHA method ²¹. Identification of bacterial isolates was based on the methods described by Cheesbrough ²² while that of fungal isolates were made possible using the method described by Frazier and WestHoff ²³.

DNA extraction method as described by Chikere and Ekwuabu ²⁴ was adopted. Five milliliter (5 ml) of an overnight broth culture of bacteria isolates in Luria bertani (LB) broth was spun using centrifuge at 1400 rpm for 3 min; the cell was suspended in 500 µl of normal saline and heated at 95°C for 20 min. The suspended bacteria already heated was fast cooled on ice and spun at 1400 rpm for 3 min. The supernatant containing DNA was transferred into 1.5 ml microcentrifuge tube and stored at -20°C. Nanodrop 1000 spectrophotometer was used to quantify the extracted genome.

Extraction of fungal DNA was done using a ZR fungal/bacterial DNA miniprep extraction kit supplied by Inqaba South Africa. Pure culture of fungal isolates which displayed heavy growth was suspended in 200 µL of isotonic buffer into a ZR bashing bead lysis tubes and 750 µL lysis solution was added to the tube. The tubes were secured in a bead beater fitted with a 2 ml tube holder assembly and processed at maximum speed for 5 mins. The ZR bashing bead lysis tubes were centrifuged at 10,000xg for 1 min. Four hundred (400) microlitres of supernatant was transferred to a Zymo-Spin IV spin filter (orange top) in a collection tube and centrifuged at 7000xg for 1 min. One thousand two hundred (1200) microlitres of fungal/bacterial DNA binding buffer was added to the filtrate in the collection tubes bringing the final volume to 1600 µL. Exactly 800 µL was then transferred to a Zymo-Spin IIC column in a collection tube and centrifuged at 10,000xg for 1 min. The flow through was discarded from the collection tube and the remaining volume was transferred to the same Zymo-spin and spun. Two hundred (200) microlitre of the DNA Pre-WAS buffer was added to the Zymo-spin IIC in a new collection tube and spun at 10,000xg for 1 min followed by the addition of 500 µL of fungal DNA Wash Buffer and centrifuged at 10,000xg for 1 min. The Zymo-spin IIC column was transferred to a clean 1.5 µL centrifuge tube, 100 µL of DNA elution buffer was added to the column matrix and centrifuged at 10,000xg for 30 sec to elute DNA. The ultra pure DNA was then stored at -20 ^o C for other downstream reaction.

Aided by ABI 9700 Applied Biosystems thermal cycler, ITS region of rRNA genes of the bacterial isolates were amplified using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers at a final volume of 50 µL for 35 cycles. The polymerase chain reaction (PCR) mix was made up of X2 Dream taq Master mix supplied by Inqaba, South Africa (taq polymerase, dNTPs, MgCl₂), primers at a concentration of 0.4 M and extracted DNA which was the template. The PCR conditions were as follows: Initial denaturation, 95°C for 5 min; denaturation, 95°C for 30 sec; annealing, 53°C for 30 sec; extension, 72°C for 30 sec and final extension, 72°C for 5 min. The product was resolved on a 1.5 % agarose gel at 120 V for 15 min and then visualized using UV transilluminator.

The 16S rRNA region of the rRNA genes of the isolates were amplified using the 27F and 1492R primers on a ABI 9700 Applied Biosystems thermal cycler at a final volume of 50 µL for 35 cycles. The PCR mix included: the X2 Dream taq Master mix supplied by Inqaba, South Africa (taq polymerase, dNTPs, MgCl₂), the primers at a concentration of 0.4 M and the extracted DNA as template. The PCR conditions were as follows: Initial denaturation, 95°C for 5 min; denaturation, 95°C for 30 sec; annealing, 52°C for 30 sec; extension, 72°C for 30 sec for 35 cycles and final extension, 72°C for 5 min. The product was resolved on a 1 % agarose gel at 120 V for 15 min and visualized on a UV transilluminator.

BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa was used for sequencing amplified 16S rRNA of the isolates.

The sequences obtained were edited using the Bioinformatics Algorithm Trace Edit. Similar sequences were downloaded from the National Center for Biotechnology Information (NCBI) database using BLASTN. These sequences were aligned using ClustalX. The evolutionary history was inferred using the Neighbor-Joining method in MEGA 6.0 ²⁵. The bootstrap consensus tree inferred from 500 replicates is taken to represent the evolutionary history of the taxa analyzed ²⁶. Jukes-Cantor method was used to compute the evolutionary distances ²⁷.

3. Results

Table 1 shows the colonial morphology and biochemical characteristics of Salmonella sp., Staphylococcus sp., Bacillus sp. and Escherichia coli isolated from packaged and exposed cassava, yam and plantain flour. Frequency of occurrence of bacterial isolates from all the flour samples presented in Figure 1 shows that Bacillus sp. (46.67 %) was predominant but Salmonella sp. (3.33 %) had the least frequency of occurrence. The characteristics of fungi isolated from exposed and packaged cassava flour is presented in Table 2 and Table 3, respectively. In Table 4 and Table 5, the characteristic of fungi isolated from exposed and packaged plantain flour, respectively is reported. Similarly, Table 6 and Table 7 describes the characteristics of fungi isolated from packaged and exposed yam flour. Frequency of occurrence of fungal isolates from packaged and exposed cassava, yam and plantain flour is stated in Figure 2. Agarose gel electrophoresis showing the amplified 16S rRNA and ITS (600bp) of the bacterial and fungal isolates is reported in Figure 3 and Figure 4, respectively. Table 8 shows the result of presumptive and molecular characterization of isolates from exposed and packaged cassava, yam and plantain flour. Phylogenetic tree showing evolutionary relationship between the fungal and bacterial isolates is reported in Figure 5 and Figure 6, respectively.

4. Discussion

A total of fourteen fungal genera were isolated from the flour samples of which Microsporum sp., Candida sp. and Aspergillus sp. were predominant. In a related study, Ajayi ¹⁵ reported that Aspergillus niger, A. fumigatus, Penicillium chrysogenum, Saccharomyces cerevisiae, Fusarium spp. Rhizopus stolonifer and Mucor spp. were present in wet and dry plantain. Studies carried out by Omohimi et al. ² and Odetunde et al. ¹⁴ also reported that Aspergillus sp. and Penicillium sp. was predominant in retailed yam and cassava flours. The presence of fungal isolates in cassava, yam and plantain flour could have resulted from contamination during processing. A related study by Somorin et al. ¹² identified Aspergillus niger, A. flavus, Penicillium oxalicum, P. citrinum from milling machines used in yam flour processing.

This study has shown that Escherichia coli were present in the edible flour samples which recorded 10 % frequency of occurrence. A related study by Ojokoh and Gabriel ²⁸ reported that E. coli was present in yam flour which they suggested could be as a result of improper handling of the flour samples as well as washing and steeping water used during processing. According to Gacheru et al. ⁸, E. coli was only detected in one sample of cassava flour out of many samples that were tested. The presence of E. coli in the edible flour samples is an indication of degree of feacal contamination both from human and animals. Presence of E. coli in plantain flour was reported by Ajayi ¹⁵. Contamination of food by Escherichia coli including other food borne pathogens such as Staphylococcus aureus and Bacillus cereus poses a threat to public health ²⁹.

Bacillus sp. was the predominant bacteria isolated from exposed and packaged cassava, plantain and yam flour. Its frequency of occurrence was 46.67 %. This result is in agreement with a similar study by Addo et al. ³⁰. Bacillus sp. is a spore former widely distributed in nature. The spores can withstand very high temperature and has the ability to produce enterotoxins which is poisonous to humans ³¹. In a related study that involved microbiological quality of plantain flour, Ajayi ¹⁵ also isolated Bacillus cereus from plantain flour.

Another dominant bacterium isolated from exposed and packaged cassava, yam and plantain the flour samples was Staphylococcus sp. which recorded 40 % frequency of occurrence. In a related study, Somorin et al. ¹² isolated S. aureus, S. saprophyticus, S. epidermidis from commercially milled white yam flour. The commonest specie of Staphylococcus ubiquitous in nature is S. aureus ³². Enterotoxins released by S. aureus are responsible for staphylococcal food-borne disease (SFD). Globally, SFD is considered as one of the most common food-borne diseases. This could be as a result of improper food handling practices especially in retail food industry ^{33, 34}. Foods such as flour extensively manipulated using hand is often associated with staphylococcal food poisoning ³².

Among the four bacterial genera isolated from cassava, plantain and yam flour samples, Salmonella sp. had the lowest frequency of occurrence (3.33 %). Although the frequency of occurrence is low, its presence only in exposed plantain flour obtained from OM open market should be considered as a threat to public health ¹³. Although Djeri et al. ³⁵, reported absence of Salmonella sp. in yam chips used in processing yam flour, contamination of the final product could still occur. Salmonella sp. is a causative agent of salmonellosis which is a food borne disease. Inappropriate storage of food and preparation of food in a very large quantity are some of the factors that increase the risk of food poisoning caused by Salmonella sp. ³⁶.

The presence of Aspergillus sp. in the flour samples should be a thing of serious concern because it could produce aflatoxins. Poor storage conditions and traditional processing methods could encourage growth of Aspergillus sp. in cassava products such as cassava flour ³⁷. Penicillium sp. infection could cause rhinocerebral mucormycosis, mucocutaneous, genitourinary, gastrointestinal, pulmonary and disseminated infections ¹⁵. Microsporum is among dematophyte species that cause Tinea capitis which is predominant disease that affect preadolescent children ^{38, 39, 40}. Candida sp. and Alternaria sp. are among common fungi that could contaminate or cause food spoilage. For example Candida kefyr could cause bloodstream infection ⁴¹.

Molecular characterization results revealed that Bacillus sp. showed 100 % similarity to Bacillus megaterium strain WSH10 16S, Salmonella sp. showed 100 % similarity to Enterobacter sp. strain HZ21, Staphylococcus sp. showed 100 % similarity to Alcaligenes feacalis strain CGAGPBS and Staphylococcus sp. showed 100 % similarity to Acinetobacter junii strain SB132. As for the fungal isolates, Aspergillus sp. showed 98.8 % similarity to Aspergillus niger strain NI26, Candida sp. showed 99.6 % similarity to Paecilomyces sinensis strain Gr133 and Microsporum audounii showed 99.6 % similarity to Tramestes polyzona strain CNRMA14.236. The result emanating from molecular characterization of bacterial and fungal isolates was submitted to GenBank in NCBI database using assigned accession number of Bacillus megaterium (MG825417), Enterobacter sp. (MG825418), Alcaligenes feacalis (MG825419), Acinetobacter junii (MG825423), Aspergillus niger (MG825420), Paecilomyces sinensis (MG825421) and Tramestes polyzona (MG825422). Aruwa and Ogundare ⁹, reported the presence of Acinetobacter sp. Enterobacter sp. in cassava flour (pupuru)

5. Conclusion

Bacillus sp., Escherichia coli, Salmonella sp. and Staphylococcus sp. were identified as bacterial isolates while Microsporum sp., Exserohilum sp., Trichoderma sp., Candida sp., Aspergillus sp., Phaeoacremonim sp., Epicoccum sp., Exophiala sp., Penicillium sp., Cokeromyces sp., Aureobasidium sp., Rhodotorula sp., Fonsecaea sp. and Phoma sp. were fungal isolates identified in the flour samples using standard microbiological methods. Further characterization of the isolates using molecular methods revealed the bacterial isolates to be Bacillus megaterium strain WSH10 16S, Enterobacter sp. strain HZ21, Alcaligenes feacalis strain CGAPGPBS and Acinetobacter junii strain SB132 while that of fungal isolates are Aspergillus niger strain NI26, Paecilomyces sinensis strain Gr133 and Tramestes polyzona strain CNRMA14.236. In addition to using conventional microbiological methods to identify bacteria and fungi present in packaged and exposed cassava, yam and plantain flour sampled from selected supermarkets and open markets in Port Harcourt, Rivers State, Nigeria, this study has also provided useful information by identifying the strains involved using molecular methods.

Competing Interests

Authors have declared that no competing interests exist.

Funding Statement

This study was funded by the authors.

References