Rapid High Specific Method for the Detection of Pseudomonas fluorescens
Department of Biotechnology, College of Science, University of Baghdad, Baghdad, IraqAbstract
The molecular detection Pseudomonas fluorescens has a vital importance for clinical and environmental microbiologist. Therefore this work aimed to establish a specific and sensitive method for diagnosis of this bacterium. To perform this aim ten Ps. fluorescens, eight closely related Pseudomonas isolates and another four common bacteria (Escherichia coli, Proteus mirabilis, klebsiella pneumonia and Bacillus sp) were collected and their detection were confirmed by 16S rRNA sequencing. Scanning the complete genome of Ps. fluorescens available in GenBank have denoted for the distinction of cumene dioxygenase. A couple of primer was designed to amplify 498 bp of cumene dioxygenase from Ps. fluorescens. The PCR using these primers resulted in single band when DNA purified from Ps. fluorescens isolates were used as template more over none of the of the DNA extracted from other isolates used in the study was resulting in any band at the experiment condition. The targeted band was amplified when serial dilution of Ps. fluorescens DNA (400, 200, 100, 50, 25, 12, 6, 3, 2, 1, 0.5 ng /μl) used as template in PCR pointing the high sensitivity of the method. Therefore this work is presenting a sensitive and specific method for the detection of Ps. fluorescens.
Keywords: Ps. fluorescens, cumene dioxygenase, PCR
Received August 19, 2015; Revised September 04, 2015; Accepted September 27, 2015
Copyright © 2015 Science and Education Publishing. All Rights Reserved.Cite this article:
- Mohammed Abdullatif Hamod. Rapid High Specific Method for the Detection of Pseudomonas fluorescens. American Journal of Microbiological Research. Vol. 3, No. 5, 2015, pp 160-164. http://pubs.sciepub.com/ajmr/3/5/2
- Hamod, Mohammed Abdullatif. "Rapid High Specific Method for the Detection of Pseudomonas fluorescens." American Journal of Microbiological Research 3.5 (2015): 160-164.
- Hamod, M. A. (2015). Rapid High Specific Method for the Detection of Pseudomonas fluorescens. American Journal of Microbiological Research, 3(5), 160-164.
- Hamod, Mohammed Abdullatif. "Rapid High Specific Method for the Detection of Pseudomonas fluorescens." American Journal of Microbiological Research 3, no. 5 (2015): 160-164.
| Import into BibTeX | Import into EndNote | Import into RefMan | Import into RefWorks |
At a glance: Figures
1. Introduction
Pseudomonas fluorescens is a member of genus Pseudomonas; this species was disregarded due to its tangency to the illustrious bacterium Ps. aeruginosa and considered to be of low level clinical significance [1]. Nevertheless it is known to cause bacteremia among oncology patients [2]. This bacterium involve in contamination of packed red blood cell unit [3]. Strains of Ps. fluorescens is responsible for the blue spoilage on fresh dairy products resulting in the so-called blue mozzarella event [4] and associated with the spoilage of poultry meat stored under chill conditions [5]. In Botany, Ps. fluorescens is a member of plant growth promoting rhizobacteria, increasingly appreciated for its contributions to primary productivity through promotion of growth and triggering of induced systemic resistance in plants [6]. On other hand it involves in massive soft rot of many vegetables due to production of pectate lyases enzyme [7]. This bacterium also known to be a good source for some enzymes of commercial value such as lipase [8] and proteinase [9].
Apart of conventional methods in detection of Pseudomonas, the molecular methods prove to be highly demanded to the diagnosis of Pseudomonas up to the level of species, due to its ease, rapidness and honesty. PCR emerged as a gold standard for the detection of many bacterial strains including Pseudomonas [10]. A successful PCR detection for the Ps. aeruginosa targeted the exotoxin A gene [11] while Investigating the extra cytoplasmic function gene by PCR has increased the specific detection of Ps. aeruginosa [12, 13]. 23S rRNA gene amplification represents an ideal molecular method for the identification of Ps. pseudomallei [14]. syrD gene responsible for the syringomycin production, was utilized in specific detection of Ps. syringae PCR detection [15]. The plant pathogen Ps. savastanoi molecular diagnosis depended on the detection of a unique DNA sequence responsible for the expression of (indole-3-acetyl)-L-lysine synthethase [16]. Ps. stutzeri environmentally important bacterium for their denitrification activity, was detected through the PCR and Real-Time PCR depending on the nitrite reductase gene [17] Tolaasin gene dependant PCR protocol appeared to be effectively distinguish Ps. Tolaasii [18]. The 16S rRNA is one of the most important marker used in bacterial genotyping was used for the PCR detection of the fish pathogen Ps. anguilliseptica [19]. Ps. fragi, Ps. lundensis, and Ps. putida were also detected by PCR methods [20]. Although Ps. fluorescens by PCR was carried out depending on a central region of flagellin gene, however the close similarity of the fliagellin gene of Ps. fluorescens with that of Ps. putida caused cross reaction in some occasion which render the specific molecular detection for Ps. fluorescens [21]. The cumene dioxygenase is an enzyme that act on hydrocarbon degradation produced by Ps. fluorescens [22]. Therefore the aim of this work was to develop a PCR protocol for the specific detection of Ps. fluorescens based on a unique sequence of cumene dioxygenase.
2. Materials and Methods
2.1. Bacterial IsolatesThe bacterial isolates used in the study where provided by the microbial store of Department of Biotechnology, College of Science, University of Baghdad and illustrated in Table 1. The isolates were cultured on brain heart infusion broth or brain heart infusion agar and incubated at 37°C and 25°C for the isolates from human and soil origin respectively.
Genomic DNA extraction carried out based on automated method using ExiPrep 16 Plus (Bioneer, Republic of Korea). 0.2 ml of the fresh bacterial culture were predicated by centrifugation 6000 RPM for 10 min. The pellet was resuspended with the lysis buffer (Provided by manufacturing company) and incubated at 37°C for 30 min then loaded to extraction cartridge (Provided by manufacturing company). DNA was eluted by 50 μl elution buffer (Provided by manufacturing company). The DNA sample measured for their concentration and purity using Microvolume UV Spectrophotometer (ACTGene, USA).
2.3. PCR, Sequencing and in selecoThe primers cdsF:TTGAGCCCCGTTACATCTTC and cdsR:GGGGAACCCACCTAGGATAA were designed, based on the cumene dioxygenase gene sequence in the GenBank (accession no. D37828.1). Universal bacteria 16S rRNA gene forward and reverse primers (forward: TGGA GAGTTTGATCCTGGCTCAG, reverse: TACCGCGGCTGCTGGCAC) were used to amplify 16S rRNA gene in all the bacterial isolates in the study based on Hall et al. [23]. PCR was performed in a 50 μl mixture containing 1× PCR buffer (10 mM Tris–HCl, 1.5 mM MgCl2, 50 mM KCl [pH 9]) (Merck, India), 100 μM (each) deoxynucleoside triphosphates, 1 U of Taq DNA polymerase (Merck, India), 10 pM each of forward and reverse primers, and 100 ng of templet DNA. The program for PCR included an initial denaturation 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 60 s, annealing at 58 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 7 min. The PCR products were resolved on a 2% agarose gel, stained with ethidium bromide (5 ng ml−1) and bands observed using a gel documentation system (ATTA, Japan). PCR products were sent for sequencing at Scigenom, India. The generated sequences were compared and analyzed against the standard sequences in the GenBank by the BLAST resources from the NCBI to unravel the identity of our gene sequences
2.4. Minimal Sensitivity.In order to determine the lowest DNA concentration required for PCR identification for the Ps. fluorescens using our protocol, DNA extracted from Ps. fluorescens (S2) was diluted in distilled water to give concentration of 400, 200, 100, 50, 25, 12, 6, 3, 2, 1, 0.5 ng /μl. 2 μl of template DNA was added from each dilution to the PCR reaction.
3. Results and Discussion
All the bacterial isolates gave high growth after 18 h of incubation at the optimum temperature. DNA purification through the described method, provide high DNA concentration range between 295 and 1091 ng /μl, with average concentration 575.3 ng /μl. The purity f the samples were acceptable as shown in Table 2 and suitable for further PCR steps.
The Ps. fluorescens isolates examined in study were detectable by producing a significant PCR product of 498 bp (as shown in Figure 1) using the amplification conditions in our experiment. On contrary other Pseudomonas isolates used in the study and the other bacterial isolates were negatively reacted with cdsF primers (Figure 2). The sensitivity of the PCR in the detection of diluted concentration of Ps. fluorescens was the similar to the use of high concentration as in Figure 3. The amplification of 16S rRNA gene resulted in single band of 542 bp. Sequencing of PCR product reveals the sequence of 498bp. Sequence alignment results using BLAST tool of NCBI confirm 99% of similarity of our sequence with sequences of cumene dioxygenase gene from Ps. fluorescens available in GenBank of NCBI. The sequencing and alignment of 16S rRNA gene have confirmed the biochemical diagnosis.
Download as
Download as
In spite of the enthusiastic shift to the rapid methods in the detection of microorganisms, however there are very limited trials have been carried out to develop a rapid method for the detection of Ps. fluorescens. Therefore till 2012, there were seen papers depending on biochemical characters alone for the detection of Ps. fluorescens [24]. Denning et al., [21], used flagellin gene for the fast detection of Ps. fluorescens in a PCR dependant method. However this method had limited application in the specific detection of the species due to the variability of the flagellin gene in different strains and the close relatedness of the gene with flagellin gene of other Pseudomonas especially Ps. putida. To solve this matter this work came to point out a unique gene or DNA sequences that can be utilized in the specific detection of Ps. fluorescens b y a molecular mean. Therefore the starting tip of this work was the search for unique genes in Ps. fluorescens from the sequences available in the GenBank of NCBI (http://www.ncbi.nlm.nih.gov), the genetic particularity was examined through by scanning the function of each gene and the sequence's percentage of similarity with other genes procured by the use of BLAST tool [25]. The cumene dioxygenase gene from Ps. fluorescens GenBank (accession no. D37828.1) reveals significant particularity through its sequence distinction (data not shown). A pair of PCR primers were designed from the most distinctive sequences in the cumene dioxygenase gene of Ps. fluorescens. The primers show excellent ability to detect all the ten Ps. fluorescens isolates used in the experiment as it seen in Figure 1. To prove the potency of the method in specific detection of the targeted species the experiment usually repeated using the same PCR conditions with DNA template of another closely related species and some of highly distributed bacteria [26]. Hence eight Pseudomonas other than Ps. fluorescens and 4 non Pseudomonas bacterial isolates were procured from the department of Biotechnology, University of Baghdad, as described in Table 1. All the isolates were previously diagnosed to the level of species based on extensive biochemical tests. The results (Figure 2) reveal that no PCR product were noticed in all bacterial isolates except.
Download as
Ps. fluorescens, increasing the value of this method in the specific rapid detection of Ps. fluorescens. To confirm the previous diagnosis of the bacterial isolates used in this investigation the most conserved gene in prokaryotes (16SrRNA) was amplified by PCR using previously evaluated primers [23]. The product sequenced and aligned and the results confirmed the biochemical diagnosis in all the cases. The positive result of detection cumene dioxygenase gene in series of DNA dilution (Figure 3) raising the possible application of this work in the rapid and accurate detection of Ps. fluorescens.
References
| [1] | Simor, A. E., Ricci, J., Lau, A., Bannatyne, R. M., and Ford-Jones L. Pseudobacteremia due to Pseudomonas fluorescens. Pediatr. Infect. Dis. 1985. Vol. 4, no. 5, pp. 50-512. | ||
In article | View Article | ||
| [2] | Hsueh, P., Teng, L., Pan, H., Chen, Y., Sun, C., Ho, S., and Lhu, K. Outbreak of Pseudomonas fluorescens Bacteremia among Oncology Patients. J. Clin. Microbiol. 1998. Vol. 36, No. 10, pp. 2914-2917. | ||
In article | PubMed | ||
| [3] | Kessler, R.J., Rankin, S., Young, S., O'Shea, K., Calabrese, M., Guldin, A., Lipson, N., Oakley, D.A., and Giger, U. Pseudomonas fluorescens contamination of a feline packed red blood cell unit and studies of canine units. Vet. Clin. Path. 2010. Vol. 39, no. 1:pp. 29-38. | ||
In article | View Article PubMed | ||
| [4] | Nogarol, C., Acutis, P.L., Bianchi, D.M., Maurella, C., Peletto, S., Gallina, S., Adriano, D., Zuccon, F., Borrello, S., Caramelli, M., and Decastelli, L. Molecular characterization of Pseudomonas fluorescens isolates involved in the Italian "blue mozzarella" event. J. Food Protect. 2013. Vol.76, no, 3. pp. 500-504. | ||
In article | View Article PubMed | ||
| [5] | Mead, G.C., and Adams, B.W.A. Selective medium for the rapid isolation of pseudomonads associated with poultry meat spoilage. Brit. Poultry Sci. 1977. Vol.18, no, 6, pp. 661-70. | ||
In article | View Article PubMed | ||
| [6] | Hol, W.H.G., Bezemer, T.M., and Biere, A. Getting the ecology intointeractions between plants and the plant growth promoting bacterium Pseudomonas fluorescens. Frontiers Plant Sci. 2013.vol. 4, pp. 1-9. | ||
In article | View Article PubMed | ||
| [7] | Liao, C.H. Analysis of pectate lyases produced by soft rot bacteria associated with spoilage of vegetables. Appl. Environ. Microbiol. 1989. Vol. 55, no. 7, pp. 1677-1683. | ||
In article | PubMed | ||
| [8] | Sztajer, H., Borkowski, J., and Sobiech, K. Purification and some properties of Pseudomonas fluorescens lipase. Biotechnol. Appl. Biochem.1991. 13, no. 1, pp. 65-71. | ||
In article | PubMed | ||
| [9] | Kumura, H., Mikawa, K., and Saito, Z. Purification and some properties of proteinase from Pseudomonas fluorescens No. 33. J. Dairy Res. 1993. Vol.76, no. 8, pp. 2164-2167. | ||
In article | View Article | ||
| [10] | Bej, A.K., Mahbubani, M.H., Dicesare, J.L., and Atlas, R.M. Polymerase chain reaction-gene probe detection of microorganisms by using filter-concentrated samples. Appl. Environ. Microbiol. 1991. Vol. 57, no. 12, pp. 3529-3534. | ||
In article | PubMed | ||
| [11] | Khan, A.A., and Cerniglia, C.E. 1994. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Appl. Environ. Microbiol. Vol. 60, no.10, pp. 3739-3745. | ||
In article | PubMed | ||
| [12] | Lavenir, R., Jocktane, D., Laurent, F., Nazaret, S., and Cournoyer, B. Improved reliability of Pseudomonas aeruginosa PCR detection by the use of the species-specific ecfX gene target. J Microbiol Methods. 2007. Vol. 70, no. 1, pp. 20-29. | ||
In article | View Article PubMed | ||
| [13] | Tang, Y., Ali, Z., Zou, J., Yang, K., Mou, X., Li, Z., Deng, Y., Lu, Z., Ma, C., Shah, M.A., Elingarami, S., Yang, H., and He, N. Detection of Pseudomonas aeruginosa based on magnetic enrichment and nested PCR. J Nanosci Nanotechnol. 2014. Vol. 14, no. 5, pp. 4886-4890. | ||
In article | View Article PubMed | ||
| [14] | Lew, A.E., and Desmarchelier, P.M.. Detection of Pseudomonas pseudomallei by PCR and Hybridization. J. Clin. Microbiol. 1994. Vol. 32, no. 5, pp.1326-1332. | ||
In article | PubMed | ||
| [15] | Bultreys, A., and Gheysen, I. Biological and molecular detection of toxic lipodepsipeptide- producing Pseudomonas syringae strains and PCR identification in plants. Appl. Environ. Microbiol 1999. Vol. 65, no. 5, pp. 1904-1909. | ||
In article | PubMed | ||
| [16] | Penyalver, R., Garci'a, A., Ferrer, A., and Bertolini, E. Detection of Pseudomonas savastanoi pv. savastanoi in Olive plants by enrichment and PCR. Appl. Environ. Microbiol. 2000. Vol. 66, no. 6, pp. 2673-2677. | ||
In article | View Article PubMed | ||
| [17] | Grȕntzig, V., Nold, S.C., Zhou, J., and Tiedje, J.M. Pseudomonas stutzeri nitrite reductase gene abundance in environmental samples measured by Real-Time PCR. Appl. Environ. Microbiol. 2001 Vol. 66, no. 2, pp.: 760-768. | ||
In article | |||
| [18] | Lee, H.I., Jeong, K.S., and Cha, J.S. PCR assays for specific and sensitive detection of Pseudomonas tolaasii, the cause of brown blotch disease of mushrooms. Lett. Appl. Microbiol. 2002. Vol. 35, no. 4, pp. 276-80. | ||
In article | View Article PubMed | ||
| [19] | Blanco, M.M., Gibello, A., Vela, A.I., Moreno, M.A., Domínguez, L., and Fernández-Garayzábal J.F. PCR detection and PFGE DNA macrorestriction analyses of clinical isolates of Pseudomonas anguilliseptica from winter disease outbreaks in sea bream Sparus aurata. Disease of Aquatic Organism. 2002. Vol. 50, no.1, pp, 19-27. | ||
In article | |||
| [20] | Ercolini, D., Russo, F., Blaiotta, G., Pepe, O., Mauriello, G., and Villani, F. Simultaneous Detection of Pseudomonas fragi, P. lundensis, and P. putida from Meat by Use of a Multiplex PCR Assay Targeting the carA Gene. Appl. Environ. Microbiol. 2007. Vol. 73, no. 7, pp. 2354-2359. | ||
In article | View Article PubMed | ||
| [21] | Denning, N., Morgan, J.A., Whipps, J.M., Saunders, J.R., and Winstanley, C. The flagellin gene as a stable marker for detection of Pseudomonas fluorescens SBW25. Lett. Appl. Microbiol. 1997. Vol. 24, no. 3, pp. 198-202. | ||
In article | View Article PubMed | ||
| [22] | Dong, X., Fushinobu, S., Fukuda, E., Terada, T., Nakamura, S., Shimizu, K., Nojiri, H., Omori, T., Shoun, H., and Wakagi, T. Crystal Structure of the Terminal Oxygenase Component of Cumene Dioxygenase from Pseudomonas fluorescens IP01. J. Bacteriol. 2005. Vol. 187, no. 7, pp. 72483-2490. | ||
In article | View Article PubMed | ||
| [23] | Hall, L., Doerr, K.A., Wohlfiel, S.L., and Roberts, G.D. Evaluation of the MicroSeq system for identification of mycobacteria by 16S ribosomal DNA sequencing andits integration into a routine clinical mycobacteriology laboratory. J. Clin. Microbiol. 2003. Vol. 41, no. 4, pp. 1447-1453. | ||
In article | View Article PubMed | ||
| [24] | Meera, T., and Balabaskar, P. Isolation and cauterization of Pseudomonas fluorescens from rice fields. International J. Food Agricul. Vet. Sci. 2012. vol. 2, no. 1, 113-120. | ||
In article | |||
| [25] | Camacho C., Coulouris G., Avagyan V., Ma N., Papadopoulos J., Bealer K., and Madden T.L. "BLAST+: architecture and applications." BMC Bioinformatics. 2009Vol. 10, pp. 421. | ||
In article | View Article PubMed | ||
| [26] | De Vos D, Lim, A. J.r., Pirnay, J.P., Vandenvelde, M.S.C., Duinslaeger, L., Vanderkelen, A., Cornelis, P.1997. Direct detection and identificationof Pseudomonas aeruginosa in clinical samples such as skin biopsyspecimens and expectorations by multiplex PCR based on twoouter membrane lipoprotein genes, oprI and oprL. J. Clin. Microbiol. Vol. 35, no. 6, pp. 1295-1299. | ||
In article | PubMed | ||
sciepub.com
Quick Submission














In article
CiteULike
Delicious


