Vitamin D Receptor Regulates High Glucose Induced Inflammation through Inhibition of NF-κBpathway

Jing Huang, Bin Yi, Wei Zhang, Wei Li, Aimei Li, Hao Zhang

  Open Access OPEN ACCESS  Peer Reviewed PEER-REVIEWED

Vitamin D Receptor Regulates High Glucose Induced Inflammation through Inhibition of NF-κBpathway

Jing Huang1, Bin Yi1, Wei Zhang1, Wei Li1, Aimei Li1, Hao Zhang1,

1Department of Nephrology, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China

Abstract

Inflammation is thought to contribute to the progression of diabetic nephropathy (DN). Vitamin D (VD) and its receptor (VDR) have beneficial function on the pathogenesis of DN by anti-inflammation. However, the underlying mechanism for VD and VDR to inhibit inflammation in DN is missing. The inflammation and activation of NF-κBpathway in HK-2 cells were fully analyzed after high glucose and VD supplementation. High glucose promoted obvious expression of monocyte chemoattractant protein (MCP)-1 and RANTES (CCL-5) by activation of NF-κBpathway. VD supplementation inhibited the inflammation induced by high glucose through VDR, which inactivated the NF-κBpathway. The inhibition of VDR by siRNA diminished the modulation of VD on inflammation induced by high glucose. VDR regulates high glucose induced inflammation by affecting NF-κBpathway.

At a glance: Figures

Cite this article:

  • Huang, Jing, et al. "Vitamin D Receptor Regulates High Glucose Induced Inflammation through Inhibition of NF-κBpathway." Journal of Food and Nutrition Research 2.8 (2014): 517-523.
  • Huang, J. , Yi, B. , Zhang, W. , Li, W. , Li, A. , & Zhang, H. (2014). Vitamin D Receptor Regulates High Glucose Induced Inflammation through Inhibition of NF-κBpathway. Journal of Food and Nutrition Research, 2(8), 517-523.
  • Huang, Jing, Bin Yi, Wei Zhang, Wei Li, Aimei Li, and Hao Zhang. "Vitamin D Receptor Regulates High Glucose Induced Inflammation through Inhibition of NF-κBpathway." Journal of Food and Nutrition Research 2, no. 8 (2014): 517-523.

Import into BibTeX Import into EndNote Import into RefMan Import into RefWorks

1. Introduction

Diabetic nephropathy (DN), a major microvascular complication of diabetes, occurs in about 20–40% of patients with type 1 or type 2 diabetes [1, 2]. The characters of DN include excessive accumulation of extracellular matrix, thickening of glomerular basement membrane, hypertrophy and/or loss of various cell types of the glomerulus and tubules, glomerulosclerosis, and tubulointerstitial fibrosis [3]. Besides the major role played by hyperglycemia, various factors contribute to the development of DN, like activation of protein kinase C [4], and oxidative stress [5]. Additionally, increasing reports also points to a crucial role of the inflammatory process in the development and progression of DN [6, 7]. For example, diabetic mice show higher renal expressions of tumor necrosis factor-α (TNF-α) and monocyte-chemoattractant protein-1 (MCP-1) and urinary TNF-α levels compared to the controls [8]. Also, increased expression of RANTES (CCL5) is reported in diabetics and in patients with chronic kidney disease [9, 10, 11]. Thus, anti-inflammatory mediators are expected to be beneficial for the pathogenesis of DN [12, 13].

Interestingly, the anti-inflammatory function of vitamin D (VD) is widely observed in various diseases, like inflammatory bowel disease (IBD) [14], ischemia/ reperfusion injury (IRI) [15] and chronic rhinosinusitis [16]. Meanwhile, the beneficial role of VD and its receptor (VDR) in the pathogenesis of ND continues to be reported, at least, partly through anti-inflammation [17, 18, 19]. Although some reports tried to uncover the mechanism by which VD and VDR modulates the pathogenesis of DN [17, 20], the underlying mechanism for the modulation of VD and VDR on the inflammation in DN remains to fully know.

Thus, this study aims to investigate the underlying mechanism for VD and VDR to modulate inflammation caused by high dose of glucose treatment in tubule epithelial cells, focusing on the NF-κBpathway.

2. Materials and Methods

2.1. Antibodies

The specific antibodies against IKK (inhibitor of nuclear factor kappa-B kinase) (20979-1-AP) and IKBa (51066-1-AP) were purchased from Proteintech Group, Inc. (Chicago, IL, USA). The specific antibodies against VDR (SC-13133) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, Texas, U.S.A.). Specific antibodies against p65 (6956) were purchased from Cell Signaling Technology (Beverly, MA, USA).The specific antibodies against RANTES (ab52562) were purchased from Abcam (Cambridge, MA, USA). The specific antibodies against MCP-1 (ab151538) were purchased from Abcam (Cambridge, MA, USA).

2.2. Cell Culture

HK-2 cells were purchased from the China Center for Type Culture Collection (CCTCC, Wuhan, China). Cells were cultured in DMEM containing 5.5 mmol/L d-glucose (control, NG), supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin and 10% FBS, at 37°C in humidified air containing 5% CO2; cells were pass aged when 80% confluent. Inordertoinduce inflammation, cells were culturedin low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose. A high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, served as the osmotic control for HG. VD (at concentrations of 10-7, 10-8, 10-9 M) was added when the cell culture medium was changed from NG to HG medium. Cells were grown to confluence for the experiments. All experiments were performed triplicate and repeated at least 3 times. At the end of the incubation period, cell lysate were harvested and stored at -80°C until further analysis.

2.3. Determination of Cell Proliferation

The MTT assay was used to examine cytotoxicity effects of different dose of glucose and VD supplementation on HK-2 cells. Cells were seeded on a 96-well plate at a density of 1×104 cells/well. The next day, cells received different treatments. After 24 hours incubation, cells were washed with PBS, and 200 µL of MTT (0.5 mg/mL diluted in culture medium) were added to each well. After 3 hours at 37 °C in the dark, the MTT solution was removed, and 200 µL of dimethyl sulfoxide (DMSO) were added to each well to solubilize the MTT metabolic product. The absorbance of the dissolved formazan was measured at 570 nm (A570) with a microplate reader (Multiscan MK3, Thermo).

2.4. Immunoblotting

Western blot analysis was conducted according to a previous study [21]. Briefly, equal amounts of proteins obtained from cytoplasmic and nuclear fractions were separated by a reducing SDS-PAGE electrophoresis. The proteins were transferred onto PVDF membranes (Millipore, MA, USA) and blocked with 5% non-fat milk in Tris-Tween buffered saline buffer (20 mM Tris, pH 7.5,150 mM NaCl, and 0.1% Tween-20) for 3 h. The primary antibodies were incubated overnight at 4°C; the HRP-conjugated secondary antibodies were subsequently incubated for 1 h at 25C before development of the blots using the Alpha Imager 2200 software (Alpha Innotech Corporation, CA, USA). We quantified the resultant signals and normalized the data to the abundance of proliferating cell nuclear antigen and actin. Proliferating cell nuclear antigen (PCNA) and actin were used as an indicator of nuclear and cytoplasmic protein fractions, respectively.

2.5. Real-time Quantitative (RT-PCR)

Total RNA was isolated from cells using TRIZOL regent (Invitrogen, USA) and then treated with DNase I (Invitrogen, USA) according to the manufacturer’s instructions. Primers used in this study were synthesized according to either previous protocols or designed with Primer 5.0. Sequences of all primers used were:

VDR-F: 5' – AGTGCAGAGGAAGCGGGAGATG - 3'

VDR-R: 5' – CTGGCAGAAGTCGGAGTAGGTG - 3'

MCP1-F: 5' – AATCACCAGCAGCAAGTGTCCC - 3'

MCP1-R: 5' – TCTTGGGTTGTGGAGTGAGTGT - 3'

RANTES-F: 5' – CTCATTGCTACTGCCCTCTGCG - 3'

RANTES-R: 5' – TTGATGTACTCCCGAACCCATT - 3'

GAPDH-F: 5' – GCACCGTCAAGGCTGAGAAC - 3'

GAPDH-R: 5' – TGGTGAAGACGCCAGTGGA-3'.

Real-time PCR was performed according to previous study [22, 23]. Relative expression of genes in the treatment group was normalized to the values for the control group.

2.6. Silencing of VDR inKH-2 Cells

siRNA targeting VDR were transiently transfected into cells using lip2000 transfection reagent(The sequence of the siRNA against VDR was 5'-CCG GGT CAT CAT GTT GCG CTC CAA TCT CGA GAT TGG AGC GCA ACA TGA TGA CTTTTT G-3'). Scrambled siRNA (non-silencing sequence) was used as a control. Briefly, cells were seeded in 6-well plates at a density of 2.5×105 cells/well. Cells were transfected with different concentrations of siRNA ranging from 10 to 50 nM for 48 h or 72 h, using lip 2000 transfection reagent. The ratio of siRNA to transfection reagent was maintained as 1:0.5 for efficient silencing without toxicity according to the manufacturer’s protocol. The final concentrations of siRNA were chosen based on dose–response studies. Forty-eight hours after the transfection, cells were used for studies.

2.7. Statistical analysis

The results are expressed as means ± SEM. Analysis of among groups was performed with a one-way ANOVA. For each analysis, P values less than 5% were considered statistically significant.

3. Results

3.1. VD regulates High Glucose Induced Inflammation

Different medium treatments had little effect on the cell proliferation from the MTT analysis (data not shown). As indicated in Figure 1, high dose of glucose treatment induced significant higher (P<0.05) mRNA expression of MCP-1 than those in control group at 24,48 and 72 hours post treatment. Indeed, the mRNA expression of MCP-1 in high glucose group was also higher (P<0.05) than those with lower dose of glucose treatment at 24 and 48 hours post treatment (Figure 1). Meanwhile, different dose of VD supplementation significantly (P<0.05) reversed the expression of MCP-1 induced by high dose of glucose treatment at 24 and 48 hours post treatment (Figure 1). However, no significant difference was observed among different dose of VD supplemented groups at 24 and 28 hours post treatment (Figure 1). Likewise, high dose of glucose treatment significantly (P<0.05) promoted the mRNA expression of RANTES, compared those in control group and those treated with lower dose of glucose at 24 and 48 hours post treatment (Figure 2). Similar to discovery from MCP-1, VD supplementation significantly (P<0.05) lowered the mRNA expression of RANTES promoted by high dose of glucose treatment (Figure 2). At 72 hours post treatment, no difference was found among glucose treated groups (Figure 2). In line with the observation in mRNA levels, high dose of glucose treatment significantly (P<0.05) increased the protein abundance of MCP-1 and RANTES at 24,48 and 72 hours post treatment, compared to the controls (Figure 3). Interestingly, higher dose of glucose treatment obviously (P<0.05) promoted the protein abundance of MCP-1 at 24 hours post treatment, and RANTES at 48 and 72 hours post treatment, compared to those with lower dose of glucose treatment (Figure 3). Different dose of VD supplementation significantly (P<0.05) lowered the increased protein abundance of MCP-1 and RANTES caused by high dose of glucose treatment at 24,48 and 72 hours post treatment (Figure 3). Notably, the effect in higher (P<0.05) dose of VD supplementation was better than the lower one (Figure 3). Summarily, high dose of glucose treatment promotes expression of MCP-1 and RANTES, and VD supplementation alleviates this promotion, especially at 24 hours post treatment. Thus later data comes from 24 hours post glucose or VD treatment.

Figure 1. mRNA expression of MCP-1. Cells were treated with DMEM containing 5.5 mmol/L d-glucose (Con), or low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, or HG medium supplemented with VD at concentrations of 10-7(HG+-7VD), 10-8(HG+-8VD), 10-9 (HG+-9VD) M. The samples were analyzed at 24 (A), 48 (B) and 72 (C) hours post treatment. Data are presented as mean ±SEM, n = 6, with a-d used to indicate a statistically significant difference (P<0.05, one way ANOVA method). MCP-1: monocyte chemoattractant protein 1
3.2. VDR Affects NF-κBpathway

As shown in Figure 4 A, high dose of glucose treatment significantly (P<0.05) increased the protein abundance of nuclear p 65 compared the controls or those with lower dose of glucose treatment. VD supplementation significantly (P<0.05) decreased the protein abundance of cytoplasmic and nuclear p 65, compared those with high glucose treatment (Figure 4 A). Interestingly, VD supplementation significantly (P<0.05) promoted the protein abundance of nuclear VDR, especially with VD supplementation at dose of 10-7 ummol/L at 24 hours (Figure 4 B). Thus, the later data came from VD supplementation at dose of 10-7 ummol/L. From Figure 5 A, high dose of glucose treatment significantly (P<0.05) affected the NF-κBpathway, including the IKK and IKBa, leading to the increased abundance of nuclear p65 and expression of MCP-1. VD supplementation significantly lowered the protein abundance of IKK, leading to the higher abundance of IKBa and lower levels of cytoplasmic and nuclear p65, resulting in lower protein expression of MCP-1, compared the cells treated with high dose of glucose along (Figure 5 A and Figure 5 B)(P<0.05). This was coincided with the higher abundance of nuclear VDR after VD supplementation (Figure 5 B). Such discovery also observed from other sets of experiment, which VD supplementation significantly (P<0,05) enhanced the expression of VDR from mRNA and protein levels (Figure 5 C, D and Figure 6 A), coinciding with the obvious inhibition of NF-kappa B pathway and the expression of MCP-1 (Figure 5 C, D and Figure 6 B) (P<0.05). Interestingly, treatment with siRNA targeting VDR significantly inhibited the expression of VDR from protein and mRNA levels, leading the activation of NF-κBpathway and the expression of MCP-1 (Figure 5 C, D and Figure 6) (P<0.05). As the control, scrambled siRNA had little effect on expression of VDR, activation of NF-κBpathway and the expression of MCP-1 (Figure 5 C, D and Figure 6). Notably, siRNAalso partly affected the regulatory role of VD supplementation on the activation of NF-κBpathway and the expression of MCP-1 (Figure 5 C, D and Figure 6) (P<0.05). As the control, scrambled siRNA had little effect VD supplementation mediated expression of VDR, activation of NF-κBpathway and the expression of MCP-1 (Figure 5 C, D and Figure 6). Summarily, VD supplementation inhibits inflammation induced by high dose of glucose treatment via VDR to inhibit NF-κBpathway.

Figure 2. mRNA expression of RANTES. Cells were treated with DMEM containing 5.5 mmol/L d-glucose (Con), or low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, or HG medium supplemented with VD at concentrations of 10-7(HG+-7VD), 10-8(HG+-8VD), 10-9 (HG+-9VD) M. The samples were analyzed at 24 (A), 48 (B) and 72(C) hours post treatment. Data are presented as mean ±SEM, n = 6, with a-d used to indicate a statistically significant difference (P<0.05, one way ANOVA method).RANTES: CCL-5
Figure 3. Protein abundance of MCP-1 and RANTES. Cells were treated with DMEM containing 5.5 mmol/L d-glucose (Con), or low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, or HG medium supplemented with VD at concentrations of 10-7(HG+-7VD), 10-8(HG+-8VD), 10-9 (HG+-9VD) M. The samples were analyzed at 24, 48 and 72 hours post treatment. Data are from one experiment representative of four experiments (biological replicates). MCP-1: monocyte chemoattractant protein 1; RANTES: CCL-5
Figure 4. Protein abundance of VDR and p65. Cells were treated with DMEM containing 5.5 mmol/L d-glucose (Con), or low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, or HG medium supplemented with VD at concentrations of 10-7(HG+-7VD), 10-8(HG+-8VD), 10-9 (HG+-9VD) M. A: protein abundance of VDR and p65 were analyzed at 24 hours post treatment. B protein abundance of nuclear VDR were analyzed at 12, 24 and 48 hours post treatment. Data are from one experiment representative of four experiments (biological replicates). VDR: VD receptor
Figure 5. The activation of NF-kappa B signaling pathway. Cells were treated with DMEM low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol or HG medium supplemented with VD at concentrations of 10-7(HG+VD) M. In some experiments, HK-2 cells were transfected with siRNA targeting VDR before treated with HG medium (HG+Si) or HG medium supplemented with VD at concentrations of 10-7(HG+VD) M (HG+VD+Si). As the control, HK-2 cells were transfected with scrambled siRNA before treated with HG medium (HG+sSi) or HG medium supplemented with VD at concentrations of 10-7(HG+VD) M (HG+VD+sSi).A and B: activation of NF-kappa B pathway was analyzed after high glucose and VD supplementation. C and D: activation of NF-kappa B pathway was analyzed after the inhibition of VDR. Data are from one experiment representative of four experiments (biological replicates). VDR: VD receptor
Figure 6. mRNA expression of VDR and MCP-1. Cells were treated with low glucose (LG) medium containing 7.5 mmol/L d-glucose or high glucose (HG) medium containing 30 mmol/L d-glucose or a high mannitol (M) medium, containing 5.5 mmol/L glucose and 54.5 mmol/L mannitol, or HG medium supplemented with VD at concentrations of 10-7M(HG+-7VD). Meanwhile, HK-2 cells were transfected with siRNA targeting VDR before treated with HG medium (HG+Si) or HG medium supplemented with VD at concentrations of 10-7(HG+VD) M (HG+VD+Si). As the control, HK-2 cells were transfected with scrambled siRNA before treated with HG medium (HG+sSi) or HG medium supplemented with VD at concentrations of 10-7(HG+VD) M (HG+VD+sSi).A: mRNA expression of VDRA was analyzed after the inhibition of VDR. B: mRNA expression of MCP-1 was analyzed after the inhibition of VDR. Data are presented as mean ±SEM, n = 6, with a-d used to indicate a statistically significant difference (P<0.05, one way ANOVA method)

4. Discussion

This study has found that high dose of glucose treatment promotes inflammation in HK-2 cells based on the enhanced mRNA expression and protein abundance of MCP-1 and RANTES. MCP-1 and RANTES are regarded as the markers of renal inflammation [8, 24]. It is well documented that high glucose induces obvious inflammatory response in various cells, like podocytes and tubular epithelial cells [25], renal mesangial cells [26], and also in HK-2 cells [27], as well as even in vivo [24]. Mechanically, we found high dose of glucose treatment affects NF-κB pathway from different levels. In agreement with our study, numerous well-designed investigations have shown that high glucose treatment affects NF-κBpathway to regulate inflammatory responses [25, 27, 28]. Notably, high glucose promotes inflammation through affecting NF-κB pathway from various levels, but this is reasonable for many inflammatory regulators, like glutamine, affects a signaling pathway from various levels and even various signaling pathways associated with inflammatory responses [29, 30]. Thus, it is interesting to explore the effect of high dose of glucose treatment on activation of others pathways associated with inflammation in HK-2 cells, like signal transducer and activator of transcription (STAT), mitogen activated protein kinases (MAPK) and peroxisome proliferator-activated receptor–gamma (PPARγ) [29]. Indeed, besides NF-κB pathway, previous reports have indicated that high glucose induces inflammatory response through other signaling pathway, like PPARγ [26].

In this study, vitamin D supplementation inhibits the inflammation induced by high glucose treatment in HK-2 cells. In line with our observation, numerous compelling literature have shown that vitamin D supplementation is beneficial by reducing inflammation in various diseases, like inflammatory bowel disease (IBD) [14], ischemia/reperfusion injury (IRI) [15] and chronic rhinosinusitis [16]. For instance, 1,25(OH)2D3, an active form of vitamin D, produces dose-dependent inhibition of COX-2 expression in murine macrophages under both basal and LPS-stimulated conditions and suppresses pro-inflammatory mediators induced by LPS with suppressing the Akt/NF-κB/COX-2pathway [31]. Indeed, its benefits were also observed in diabetic nephropathy by reducing inflammation [32]. For example, Zehnder and colleges have reported that renal inflammation is associated with decreased serum vitamin D metabolites, and vitamin D attenuates TNF-α–induced MCP-1 expression by human proximal tubule cells [33].

It seems that vitamin D excises its anti-inflammatory response through its receptor for increased expression of VDR, especially the nuclear VDR, is observed. Indeed, it has reported that the active form of vitamin D, (1,25(OH)2D3) must be bound to the specific nuclear VDR to exert its function, including immunomodulatory, and anti-inflammatory functions [34]. 1,25(OH)2D3 attenuates TNFα-induced p65 nuclear translocation and NF-κB activity in a VDR-dependent manner [35]. VDR is well documented for its role in inducing inflammatory response in kidney diseases, even in DN [17, 18]. For example, five months of paricalcitol administration (a selective VDRactivator) associates with the reduction in serum concentrations of TNF-α and IL-6, and mRNA expression levels of TNFα and IL-6 genes in peripheral blood mononuclear cells in patients with chronic kidney disease [36]. The observation that the siRNA targeting VDR diminishes the anti-inflammatory response of VD supplementation also supports this conclusion. Likewise, previous study has also found that knockdown of vitamin D receptor attenuates the inhibitory effect of 1,25(OH)2D3 on COX-2 expression in macrophages induced by LPS [31]. Also, it has reported that VDR(-/-) mice has increased bacterial burden and mortality, and serum IL-6 levels after salmonella infection [37].

Mechanically, VDR excises anti-inflammatory responses by targeting the NF-κBpathway. It has shown that the VDR physically interacts with IKKβ to block NF-κB activation, leading to block TNFα-induced IL-6 up-regulation [35]. Besides that, VDRforms a complex with NF-κBp65 to affect p65 nuclear translocation and NF-κBactivity in intestinal epithelia [37], and the activation of NF-κBDNA binding activity as well as NF-κB-driven reporter gene activity in keratinocytes [38]. Also, it could increase the mRNA and protein levels of the NF-κBinhibitor protein, IKBa [38]. However, it is worthy to know its function on others pathways associated with inflammation, like MAPK.

5. Conclusion

In conclusion, high dose of glucose treatment promotes inflammation response in HK-2 cells through affecting NF-κBpathway. VD supplementation diminishes the high glucose induced inflammation by VDR to target NF-κBpathway.

Acknowledgement

This study was in part supported by the Natural Science Foundation of Hunan Province(NO. 13JJ3033), and the Scientific and Technological Project of Hunan Province(NO. 2011FJ3217).

Author’s Contribution

All authors have contributed in designing and conducting the study. Bin Yi, Wei Zhang, Wei Li, Aimei Li helped the experiments and collected the data and Hao Zhang did the analysis. All authors have assisted in preparation of the first draft of the manuscript or revising it critically for important intellectual content. All authors have read and approved the content of the manuscript and are accountable for all aspects of the work.

Statement of Competing Interests

The authors have no competing interests

References

[1]  Dronavalli S, Duka Iand Bakris GL. “The pathogenesis of diabetic nephropathy”. Nat Clin Pract Endocrinol Metab, 4 (8). 444-52, Aug, 2008.
In article      CrossRef
 
[2]  Kanwar YS, Wada J, Sun L, Xie P, Wallner EI and Chen S, Chugh S and Danesh FR. “Diabetic nephropathy: mechanisms of renal disease progression”. Exp Biol Med (Maywood), 233(1). 4-11, Jan, 2008.
In article      CrossRef
 
[3]  Jefferson JA, Shankland SJ and Pichler RH. “Proteinuria in diabetic kidney disease: a mechanistic viewpoint”. Kidney Int, 74 (1). 22-36, Jun, 2008.
In article      CrossRef
 
[4]  Noh H and King GL. “The role of protein kinase C activation in diabetic nephropathy”. Kidney Int Suppl, (106). S49-53, Aug, 2007.
In article      
 
[5]  Forbes JM, Coughlan MT and Cooper ME. “Oxidative stress as a major culprit in kidney disease in diabetes”. Diabetes, 57 (6). 1446-54, Jun, 2008.
In article      CrossRef
 
[6]  Saraheimo M, Teppo AM, Forsblom C, Fagerudd J and Groop PH. “Diabetic nephropathy is associated with low-grade inflammation in Type 1 diabetic patients”. Diabetologia, 46 (10). 1402-7,Oct, 2003.
In article      CrossRef
 
[7]  Dalla Vestra M, Mussap M, Gallina P, Bruseghin M, Cernigoi AM, Saller A, Plebani M and Fioretto P. “Acute-phase markers of inflammation and glomerular structure in patients with type 2 diabetes”. J Am Soc Nephrol, 16 Suppl 1. S78-82,Mar, 2005.
In article      CrossRef
 
[8]  Guo X, Zhou G, Guo M, Cheung AK, Huang Y and Beddhu S. “Adiponectin retards the progression of diabetic nephropathy in db/db mice by counteracting angiotensin II”. Physiol Rep, 2 (2).
In article      
 
[9]  Benito-Martin A, Ucero AC, Izquierdo MC, Santamaria B, Picatoste B, Carrasco S Lorenzo O, Ruiz-Ortega M, Egido J and Ortiz A. “Endogenous NAMPT dampens chemokine expression and apoptotic responses in stressed tubular cells”. Biochim Biophys Act, 1842 (2). 293-303,Feb, 2014.
In article      CrossRef
 
[10]  Har R, Scholey JW, Daneman D, Mahmud FH, Dekker R, Lai VElia Y, Fritzler ML, Sochett EB, Reich HN and Cherney DZ. “The effect of renal hyperfiltration on urinary inflammatory cytokines/chemokines in patients with uncomplicated type 1 diabetes mellitus”.Diabetologia, 56 (5). 1166-73,May, 2013.
In article      CrossRef
 
[11]  Cherney DZ, Scholey JW, Daneman D, Dunger DB, Dalton RN, Moineddin R MahmudFH, Dekker R, Elia Y, Sochett E and Reich HN. “Urinary markers of renal inflammation in adolescents with Type 1 diabetes mellitus and normoalbuminuria”. Diabet Med, 29 (10). 1297-302, Oct, 2012.
In article      CrossRef
 
[12]  Marques C, Mega C, Goncalves A, Rodrigues-Santos P, Teixeira-Lemos E, Teixeira F, Fontes-Ribeiro C, Reis F and Fernandes R. “Sitagliptin prevents inflammation and apoptotic cell death in the kidney of type 2 diabetic animals”. Mediators Inflamm, 538737, 2014.
In article      
 
[13]  Zhou Y, Lv C, Wu C, Chen F, Shao Y, Wang Q. “Suppressor of cytokine signaling (SOCS) 2 attenuates renal lesions in rats with diabetic nephropathy”. Acta Histochem.
In article      
 
[14]  Reich KM, Fedorak RN, Madsen K, Kroeker KI. “Vitamin D improves inflammatory bowel disease outcomes: Basic science and clinical review”. World J Gastroenterol, 20 (17). 4934-47, May, 2014.
In article      CrossRef
 
[15]  Seif AA, Abdelwahed DM. “Vitamin D ameliorates hepatic ischemic/reperfusion injury in rats”.J Physiol Biochem,.
In article      
 
[16]  Mulligan JK, Nagel W, O'Connell BP, Wentzel J, Atkinson C, Schlosser RJ. “Cigarette smoke exposure is associated with vitamin D3 deficiencies in patients withchronic rhinosinusitis”. J Allergy Clin Immunol.
In article      
 
[17]  Guan X, Yang H, Zhang W, Wang H, Liao L. “Vitamin D receptor and its protective role in diabetic nephropathy”. Chin Med J (Engl), 127 (2). 365-9, 2014.
In article      
 
[18]  Yang L, Ma J, Zhang X, Fan Y, Wang L. “Protective role of the vitamin D receptor”. Cell Immunol, 279 (2). 160-6, Oct, 2012.
In article      CrossRef
 
[19]  Koroshi A, Idrizi A. “Renoprotective effects of Vitamin D and renin-angiotensin system”. Hippokratia, 15 (4). 308-11, Oct, 2011.
In article      
 
[20]  Sanchez-Nino MD, Bozic M, Cordoba-Lanus E, Valcheva P, Gracia O, Ibarz M Fernandez E, Navarro-Gonzalez JF, Ortiz A and Valdivielso JM. “Beyond proteinuria: VDR activation reduces renal inflammation in experimental diabetic nephropathy”. Am J Physiol Renal Physiol, 302 (6). F647-57, Mar, 2012.
In article      CrossRef
 
[21]  Ren W, Chen S, Yin J, Duan J, Li T, Liu G, Feng Z, Tan B, Yin Y and Wu G. “Dietary Arginine Supplementation of Mice Alters the Microbial Population and Activates Intestinal Innate Immunity”. J Nutr.
In article      
 
[22]  Ren W, Luo W, Wu M, Liu G, Yu X, Fang J, Li T, Yin Y and Wu G. “Dietary L: -glutamine supplementation improves pregnancy outcome in mice infected with type-2 porcine circovirus”. Amino Acid.
In article      
 
[23]  Ren WK, Liu SP, Chen S, Zhang FM, Li NZ, Yin J, Peng Y, Wu L, Liu G, Yin Y and Wu G. “Dietary L-glutamine supplementation increases Pasteurella multocida burden and the expression of its major virulence factors in mice”. Amino Acids, 45 (4). 947-55, Oct, 2013.
In article      CrossRef
 
[24]  Zhang MH, Feng L, Zhu MM, Gu JF, Jiang J, Cheng XD, Ding SM4, Wu C and Jia XB.”The anti-inflammation effect of Moutan Cortex on advanced glycation end products-induced rat mesangial cells dysfunction and High-glucose-fat diet and streptozotocin-induced diabetic nephropathy rats”. J Ethnopharmacol, 151 (1). 591-600, Jan, 2014.
In article      CrossRef
 
[25]  Ma J, Chadban SJ, Zhao CY, Chen X, Kwan T, Panchapakesan U, Pollock CA and Wu H. “TLR4 Activation Promotes Podocyte Injury and Interstitial Fibrosis in Diabetic Nephropathy”. PLoS One, 9 (5), e97985.
In article      CrossRef
 
[26]  Lin CL, Hsu YC, Lee PH, Lei CC, Wang JY, Huang YT, Wang SY and Wang FS. “Cannabinoid receptor 1 disturbance of PPARgamma2 augments hyperglycemia induction of mesangial inflammation and fibrosis in renal glomeruli”. J Mol Med (Berl).
In article      
 
[27]  Huang C, Pollock CA, Chen XM. “High glucose induces CCL20 in proximal tubular cells via activation of the KCa3.1 channel”. PLoS One, 9 (4). e95173.
In article      CrossRef
 
[28]  Xu F, Wang Y, Cui W, Yuan H, Sun J, Wu M, Guo Q, Kong L, Wu H and Miao L. “Resveratrol Prevention of Diabetic Nephropathy Is Associated with the Suppression of Renal Inflammation and Mesangial Cell Proliferation: Possible Roles of Akt/NF-kappaB Pathway”. Int J Endocrinol, 289327.
In article      
 
[29]  Ren WK, Yin J, Zhu XP, Liu G, Li NZ, Peng YY and Yin YL. “Glutamine on Intestinal Inflammation: A Mechanistic Perspective”. European Journal of Inflammation, 11 (2). 315-26, May-ug, 2013.
In article      
 
[30]  Ren W, Yin J, Wu M, Liu G, Yang G, Xion Y, Su D, Wu L, Li T, Chen S, Duan J, Yin Y and Wu G.”Serum amino acids profile and the beneficial effects of L-arginine or L-glutamine supplementation in dextran sulfate sodium colitis”. PLoS One, 9 (2). e88335.
In article      CrossRef
 
[31]  Wang Q, He Y, Shen Y, Zhang Q, Chen D, Zuo C, Qin J, Wang H, Wang J and Yu Y. “Vitamin D Inhibits COX-2 Expression and Inflammatory Response by Targeting Thioesterase Superfamily Member 4”. J Biol Chem, 289 (17). 11681-94,Apr, 2014.
In article      CrossRef
 
[32]  Agarwal R. “Vitamin D, proteinuria, diabetic nephropathy, and progression of CKD”. Clin J Am Soc Nephrol, 4 (9). 1523-8,Sep, 2009.
In article      CrossRef
 
[33]  Zehnder D, Quinkler M, Eardley KS, Bland R, Lepenies J, Hughes SV, Raymond NT, Howie AJ, Cockwell P, Stewart PM and Hewison M. “Reduction of the vitamin D hormonal system in kidney disease is associated with increased renal inflammation”. Kidney Int, 74 (10). 1343-53,Nov, 2008.
In article      CrossRef
 
[34]  Vojinovic J. “Vitamin D receptor agonists' anti-inflammatory properties”. Ann N Y Acad Sc.
In article      
 
[35]  Chen Y, Zhang J, Ge X, Du J, Deb DK, Li YC. “Vitamin D receptor inhibits nuclear factor kappaB activation by interacting with IkappaB kinase beta protein”. J Biol Chem, 288 (27). 19450-8, Jun, 2013.
In article      CrossRef
 
[36]  Donate-Correa J, Dominguez-Pimentel V, Mendez-Perez ML, Muros-de-Fuentes M, Mora-Fernandez C, Martin-Nunez E, Cazaña-Pérez V and Navarro-González JF. “Selective vitamin D receptor activation as anti-inflammatory target in chronic kidney disease”. Mediators Inflamm, 670475.
In article      
 
[37]  Wu S, Liao AP, Xia Y, Li YC, Li JD, Sartor RB and Sun J. “Vitamin D receptor negatively regulates bacterial-stimulated NF-kappaB activity in intestine”. Am J Pathol, 177 (2). 686-97.
In article      CrossRef
 
[38]  Janjetovic Z, Zmijewski MA, Tuckey RC, DeLeon DA, Nguyen MN, Pfeffer LM and Slominski AT.”20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes”. PLoS One, 4 (6). e5988.
In article      CrossRef
 
comments powered by Disqus
  • CiteULikeCiteULike
  • MendeleyMendeley
  • StumbleUponStumbleUpon
  • Add to DeliciousDelicious
  • FacebookFacebook
  • TwitterTwitter
  • LinkedInLinkedIn