1. Introduction

The genus Aeromonas is a member of the family Aeromonadaceae that are primarily aquatic organisms found in water ^[1]. Aeromonas infections are one of the most common bacterial diseases diagnosed in marine and cultured freshwater fish. Aeromonas hydrophila is found in diverse habitats, including soil, widely in fresh and salt water also frequently found in chlorinated and non-chlorinated drinking water, and is pathogenic to warm and cold-blooded animals ^[2]. Aquatic environment along with water and seafood is thus important potential source for the transmission of A.hydrophila resulting in human infections. Aeromonas spp. have been involved in wound infections, sepsis, outbreaks of water, and food-borne gastroenteritis ^[3]. Direct contact with contaminated water and soil is the most frequent cause of gastrointestinal and wound infections in humans ^[4].

There has been an increasing incidence of antimicrobial resistance among Aeromonas sp. isolated from aquaculture environments, five classes of genetically distinguishable tetracycline resistance determinants designated Athrough E, have been described among aerobic enteric gram-negative bacteria and Several studies have shown tetE to be the predominant determinant among the different classes of tetracyclineresistant genes (4,15).

The pathogenicity of A.hydrophila infection have been implicated in the cause of numerous human infections, such as gastroenteritis, cellulitis, meningitis, bacteremia, soft-tissue infections, peritonitis, and broncho pulmonary infections ^[5]. Various putative virulence factors (aerolysin/hemolysin, proteases, lipases, DNases, enterotoxins) that may play an important role in the development of diseases, either in humans or in fish, have been described in several species of the genus ^[6]. Some authors reported that the production of cytotoxins and hemolysin is related to A. hydrophila and A. veronii bv, and hemolytic molecules seem to be related to enterotoxigenicity ^[7]. Virulence in Aeromonas hydrophila is multifactorial which these enzymes that play significant role in pathogenesis. A.hydrophila has been an increasing incidence of antimicrobial resistance among Aeromonas sp. isolated from aquaculture environments ^[8]. Broad-spectrum antibiotics, such as tetracycline, are prescribed clinically for the treatment of such infections. Several studies have shown tetE to be the predominant determinant among the different classes of tetracycline resistant genes of A.hydrophila ^{[6, 9]}.

Molecular studies on Aeromonas species have received a little attention in Iraq and this study was considering the first molecular study in Iraq. The present study is carried out to achieve the following objectives:

1- Isolation of A.hydrophila isolates among the environmental samples and identification by API20E system and used the PCR technique, with specific primer (tetA-E) sequence gene.

2- Detection the virulence factors of A.hydrophila isolates such as heamolysin, lipase, protease and Phospholipase.

2. Methods

A total of samples collection ( 440) samples of water were obtained from Al- Jadryia bridge water in Baghdad who attended to Bacteriology laboratory in Sciences faculty during the period from August,2012 to the April,2013. They were swabbed onto thiosulfate citrate bilesalts sucrose (TCBS) agar and MacConkey agar (MC) the plates were incubated overnight.

Morphological colonies characteristics were recorded on the media that are used (MacConkey agar, blood agar and TCBS agar ) for primary identification of A.hydrophila and microscopic properties by Gram's stain was used to examine the isolated bacteria for studying the microscopic properties such as gram reaction, shape and motility ^[10]. While Biochemical tests used Oxidase test, Catalase test (Hydrogen Peroxide 3%), Simmon's Citrate test, Indole Production test, Motility test were all these tests and urease test result according to ^[11]. Also, API20E system was carried out according to the procedure of (Biomerix company, France ).

Heamolysin was detection according to^[12] tested for β-hemolytic activity on base agar (Himedia, India) supplemented with 7% sheep erythrocytes. A loopful of an overnight growth from nutrient agar were cultured on blood agar by streaking method, incubated at 37°C for 24 hr. Protease was detected by ^[13] was tested on 2% agar-agar (Himedia, India) containing 10% (w/v) skimmed milk (Himedia, India). A loopful of an overnight growth from nutrient agar were cultured on agar by streaking method, incubated at 37°C for 24 h. While Lipase detection was performed on Tween 20 agar ^[12].

PCR Assay:

The wizard genomic DNA purification kit is designed for isolation of DNA from G- bacteria by a universal extraction kit of (Promega company). Gel electrophoresis was used for detection of DNA by UV transilluminator ^[14]. Concentration of DNA was determined spectrophotometrically by measuring its optical density at 260 nm (Extinction coefficient of dsDNA is 50 µg/ml at 260 nm) the purity of DNA solution is indicated by ratio of OD260/OD280 which is in the range of 1.8± 0.2 for pure DNA ^[16]. PCR program that apply in the thermocyler. The PCR products and the ladder marker are resolved by electrophoresis on 1.2% agarose gel. ^[15].

3. Results

A total of (440) samples were collected from water of AL-Jadryia river (Baghdad city, Iraq), and was observed(71)isolate on media. The colonies of A. hydrophila are yellow shin color on TCBS agar, with diameter ranged from (2-3)mm. In addition to those colonies appeared as pale like shaped on the MacConkey agar indicated that A. hydrophila is unable to ferment lactose sugar. On blood agar A. hydrophila produces smooth, convex, rounded and β-hemolytic colonies and pale white to grey color [Figure 1].

Figure 1. A- A.hydrophila produces smooth, convex, rounded colonies: A- β-hemolytic colonies and white to grey color on Blood agar. B- Pale colonies on MacConkey agar

Download as

PowerPoint Slide

Larger image(png format)

Figures index

Veiw figure

View current figure in a new window

View next figure

Microscopical examination has revealed that (44) isolate of A.hydrophila a gram negative bacillus, straight shape, singly or pairs and rarely as short chains, and not spore forming. The results of biochemical tests were adopted as a complementary characteristic of the initial diagnosis of A.hydrophila, where the results indicated that isolates belong to A.hydrophila, all isolates are positive result for oxidase test. [Figure 1] reveals that A.hydrophila isolates are characterized by their ability to ferment glucose with gas formed on kligler iron agar (Alk/Acid), it produces (Alkaline) red color top and bottom (acidic) yellow color with gas formed but not H2S; it gives a positive result to, catalase, Indole, simmone citrate tests.

API 20E system is used to confirm identification of A.hydrophila included in this study. The results demonstrate that (36) isolate were positive in identification by API20E, as shown in [Figure 2]. Using the analytical profile index of this system the identification percentage is (id% = 93.8).

Figure 2. API 20E system for identification of A. hydrophila after 24 hrs. incubation

Download as

PowerPoint Slide

Larger image(png format)

Figures index

Veiw figure

View current figure in a new window

View previous figure

View next figure

The ability of A.hydrophila (36) isolates to produce some virulence factors. All A.hydrophila showed positive result for heamolysin production (100%), type beta (β -heamolysin ), when cultured on blood agar medium. The isolates also showed the ability to produce protease to hydrolyze the protein(100%), when inoculated on skim milk agar for 24 hours at 37°C. Also the ability to hydrolyze fats by lipase enzyme when inoculated on 1%Tween agar for (3-5)days at 37ºC.While all isolates of A.hydrophila have no ability to produced urease enzyme as shown in [Figure 3].

Figure 3. Some VirulencFactors of A.hydrophila (A)-Lipase production (B)- Protease production

Download as

PowerPoint Slide

Larger image(png format)

Figures index

Veiw figure

View current figure in a new window

View previous figure

View next figure

While, molecular identification by PCR technique has been used to amplify gene of the (tet-E) gene from genomic DNA of all A. hydrophila isolates. DNA is extracted from all isolates. The results of isolates diagnosis using the PCR technique for(tet-E) detection clarify that isolates of A.hydrophila, producers carrying (tet-E) gene by 26/36(72.22). Specific primers of aerA gene with genomic DNA of A. hy-drophila isolates were used in this study as shown in [Figure 4]. The PCR assay was performed to detect the(tetE) gene of A.hydrophila, tetA-E – Forward Primer (F) 5'- ATGAACCGCACTGTGATGATG–3' and tetA-E – Reverse Primer (R)5'- ACCGACCATTACGCCATCC -3' with size (744 bp), these primers synthesized by Alpha DNA company, Canada^[15]. The thermocyler for this primer by following : Initial denaturation 94˚C for 3 min and ( 94˚C for 30 sec, 52˚C for 30 sec, 72˚C for 30 sec for 30 cycles ) and 72˚C for 10 min final elongation. The amount (concentrations) of the PCR components were included final volume 25 µl in tube PCR by DNA template (5µl), Forward primers (2.5µl)Reverse primers (2.5µl), Gotaq master mix (12.5 µl) and distilled water (2.5 µl).

Figure 4. Agarose Gel Electrophoresis (1.2%) of PCR Amplify of (tetE) gene of A.hydrophila isolates for 55 min at 100 Volt

Download as

PowerPoint Slide

Larger image(png format)

Figures index

Veiw figure

View current figure in a new window

View previous figure

4. Discussion

The present study is conducted to isolation and identification (36) isolate of A.hydrophila bacteria from water samples of AL-Jadryia river (Baghdad city, Iraq). Aeromonas. hydrophila causes a wide range of human illnesses possible routes of transmission include contaminated water, food and exposure of wounds to environments that contain the pathogen.In general, the genus Aeromonas are facultative anaerobic, oxidase positive, Gram negative bacteria whose natural habitat is in the aquatic environment. Some species are pathogenic for animals and human.

Identification of A.hydrophila depends on the colonial morphology, biochemical tests, Api20E system and molecular identification for (tet-E) gene. The colonies of A.hydrophila are yellow shin /green color on TCBS agar due to sucrose ferment, with diameter ranged from (2-3)mm. In addition, those colonies appear as pale like shaped on the MacConkey agar that indicated A.hydrophila is unable to ferment lactose sugar. But it is grow on the blood agar with produces smooth, convex, rounded and _ -hemolytic colonies and pale white to grey color, [Figure 1], these typical characteristics being described by referential studies ^[17]. These results are agree with ^{[18, 19, 20]}. API20E system is characterizes by fast detection of bacteria without the need for many of culture media as well as reduce cultural contamination, and it is used to confirm identification of A.hydrophila, ^[21]. The isolation rate of Aeromonas hydrophila in many developing countries. In environmental isolates, Aeromonas hydrophila has been isolated in rates as high as 82% in Senegal ^[22]and in 77% of food samples in Kenya ^[23]. In the Venda region of South Africa, Aeromonas species are isolated from clinical and environmental samples ^[24].while the studies in Iraq refer that the isolation rate of A.hydrophila by 6.6% from stool cases in Baghdad^[25]who study of Ecological and physiological on A.hydrophila and role enterotoxin in pathogenicity, and 8.9% in Baghdad ^[26]which studied, some characteristics and immunological effects of A.hydrophila enterotoxin. Whereas ^[27] refer that the isolation rate reach to 9% from stool samples and 20% from Tigris water, when studied the crude growth extract effect A.hydrophila on normal and Cancer cell lines.

A.hydrophila bacteria have produced a variety of biologically active extracellular products similar to the virulence factors of enteropathogenic bacteria and these virulence factors associated with health effects in humans ^[28] and causes many diseases as significant human pathogens causing a variety of extra-intestinal infections. Extra-intestinal and gastrointestinal infections were known to occur in previously healthy hosts as well as immunocompromised or otherwise susceptible populations ^[29]. Virulence factors were present in two forms, cell-associated structures, and extracellular products. The cell-associated structures involved pili, flagella, outer membrane proteins, lipopolysaccharide, and capsules. The major extracellular products include cytotoxic, cytolytic, hemolytic, and enterotoxic proteins. Aeromonas produce an array of filamentous structures, including short rigid, and long wavy pili, as well as polar and lateral flagella. Polar flagella and lateral flagella are described by^{[30, 31]}. Polar flagellins function as adhesions, while lateral flagellum's serve as colonization factors ^[32].

The present study identifies some virulence factors associated with pathogenicity of A.hydrophila, where it is observed that all environmental isolates had ability to produce β-heamolysin (100%) which cause complete hydrolysis of RBCs on blood agar, this result similar to ^{[33, 34]}. As shown to be cytolytic for the erythrocytes and mammalian cells in culture. However, the hemolytic activity of A. hydrophila has been used as an indicator of enterotoxicity and may be responsible for outbreaks of diarrhea ^[35]. As researchers indicate that isolates had high pathogenicity and also environmental are responsible for diseases occurs in human because they secrete different toxins ^[36]. Some reports were indicated that β-heamolysin which is produced from A.hydrophila has a close relationship to the production of toxins in the cell producing enzyme, and toxin called Cytotoxic factors. Heamolysin is made in the logarithmic phase of cell growth ^[37]. and it is virulence factor important for A.hydrophila bacteria. On other hand, in this study was reveal that A.hydrophila were able to hydrolyze the protein by protease enzyme(100%) when tested on skim milk agar, and these results were agree with ^{[38, 39]} who indicates that A.hydrophila is producing protease enzyme. Protease enzyme secreted outside of the cell through a process of growth as they accumulate significantly in the phase stability of the bacteria, and it is one of virulence factors important for A.hydrophila bacteria ^[40].

A variety of antibiotics have been used to treat infection caused by A.hydrophila and have proved useful in many cases, but multiple antibiotic resistances are common among A.hydrophila ^[28]. Many strains of A.hydrophila are known to harbour mobile elements that encode antibiotic resistance and can be transferred among themselves or to other bacterial speciesʼ to establish multiple antibiotic resistances ^[41]. The widespread use of antibiotics has been identified as a major factor responsible for the increased incidence of antibiotics resistance ^[1]. Molecular identification of (tetE) gene by PCR used to amplify a precise fragment of DNA from a complex mixture of starting material usually template genomic DNA. A number of reports are available for PCR amplification of conserved (tetE) gene of A. hydrophila ^[42]. The present study showed that most of isolates of A.hydrophila produces carrying (tet-E) gene by 26/36(72.22). Specific primers of aerA gene with genomic DNA of A. hydrophila isolates were used in this study as shown in [Figure 4]. The results of this study agree with several studies ^{[37, 43]}. This results leading to higher level of resistance to is recorded for these antibiotic may be caused by initial mutation located in a single site on the A.hydrophila chromosome ^[43].

5. Conclusions

The following conclusions are extracted from the present study:

1- The frequency of A.hydrophila isolates in water of AL-Jadryia river (Baghdad city) was higher in environmental isolates.

2-The molecular study provides definite identification of antibiotics gene such as tetracycline gene.

3-Most environmental isolates produced many virulence factors involve heamolysin, lipase and protease.

References

[1]	Andrea. B; Cyrino,J.E.P.(2006). Antibiotic Resistance of Aeromonas hydrophila isolated from Piaractus mesopotamicus (Holmberg, 1887) and Oreochromis niloticus (Linnaeus, 1758). UFAM - Centro de Apoio Multidisciplinar - Divisão de Biotecnologia, Av. Rodrigo Otávio, 3000 - 69077-900 -Manaus, AM - Brasil.
	In article
[2]	Palu AP, Gomesb LM, Miguela MAL, Balassianoa IT, Queirozb MLP, Freitas-Almeidab AC, de Oliveiraa SS., 2006. Antimicrobial resistance in food and clinical Aeromonas isolates. Food Microbiol 23: 504-509.
	In article		CrossRef
[3]	Yousr, A.H.; Napis,S.; Rusul,G.R.A. and Son, R.(2007). Detection of Aerolysin and Hemolysin Genes in Aeromonas spp. Isolated from Environmental and Shellfish Sources by Polymerase Chain Reaction. ASEAN Food Journal 14 (2): 115-122.
	In article
[4]	Janda, J. M., R. P. Kokka, and L. S. Guthertz. (1994). The susceptibility of S-layer-positive and S-layer-negative Aeromonas strains to complement mediated lysis. Microbiology 140: 2899-2905.
	In article		CrossRef
[5]	Brouqui,P. and D.Raoult. (2001). Endocarditis due to rare and fastidious bacteria. Clin. Microbiol. Rev. 14:177-207.
	In article		CrossRef
[6]	Schmidt A.S, Bruun M.S, Dalsgaard I and Larsen J.L (2001), Incidence, distribution, and spread of tetracycline resistance determinants and integronassociated antibiotic resistance genes among motile aeromonads from a fish farming environment. Journal of Applied Environmental Microbiology 67: 5675-5682.
	In article		CrossRef
[7]	Lee, W.S., and Puthucheary, S. D.(2001). Retrospective study of Aeromonas infection in a Malaysian urban area: a 10-year experience. Singapore Med. J. 42:057-060.
	In article
[8]	Rhodes G, Huys G, Swings J, Mcgann P, Hiney M, Smith P, Pickup RW (2000). Distribution of oxytetracycline resistance plasmids between aeromonads in hospital and aquaculture environments: Implication of Tn1721 in dissemination of the tetracycline resistance determinant, Tet A. Appl. Environ. Microbiol., 66: 3883-3890.
	In article		CrossRef
[9]	Miranda, C.D; Kehrenberg C, Ulep C, Schwarz S, Roberts MC (2003). Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms. Antimicrob. Agents Chemother., 47: 883-888.
	In article		CrossRef
[10]	Jawetz, E ; Melnick, J.I. and Adelberg, E.A. (2007). Medical Microbiology. (24nd ed.). Appleton and Lange U.S.A.
	In article
[11]	MaccFadin, J.K. (2000). Biochemical test for identification of medical bacteria. (3rd ed.). Lippincott Williams and Winkins. Awolter Klumer Company. Philadelphia Baltimor. New York.
	In article
[12]	Collee, J.G.; Fraser, A.G.; Marmino, B.P.; and Simons, A. (1996). Mackin and McCartney Practical Medical Microbiology. 14thed. The Churchill Livingstone, Inc. U.S.A.
	In article
[13]	Benson, H.J. (2002). Microbiological Applications: Laboratory Manual in General Microbiology. (8th ed). Complete version. McGraw-Hill. U.S.A.
	In article
[14]	Sambrook, J., and Russell, R.W.(2001). Molecular cloning: A laboratory manual, 3rd ed. Cold spring harbor laboratory press, cold spring harbor, N.Y.
	In article
[15]	Jun, J.W.; Kim, J.H.; Gomez, D.K.; Choresca Jr, C.H.; Han, J.E.; Shin, S.P., and Park. S.C.(2010). Occurrence of tetracycline-resistant Aeromonas hydrophila infection in Korean cyprinid loach (Misgurnus anguillicaudatus).African Journal of Microbiology Research Vol. 4(9), pp. 849-855, 4 May, 2010.
	In article
[16]	Stephenson, F.H.(2003).Calculations in Molecular biology and biotechnology. Academic press, California, USA.
	In article
[17]	Abbott, S. L.; Cheung, W. K., and Janda, J. M. (2003).The genus Aeromonas: biochemical characteristics, atypical reactions, and phenotypicidentification schemes. J. Clin. Microbiol. 41, 2348-23.
	In article		CrossRef
[18]	Altwegg, M., and Geiss, H. K. (1989). Aeromonas as a human pathogen. CRC Crit. Rev. Microbiol. 16:253-286.
	In article		CrossRef
[19]	Jayavignesh,V.;Sendesh Kannan K. and Bhat. A.D.(2011). Biochemical characterization and cytotoxicity of the Aeromonas Hydrophila isolated from Catfish. Arch. Appl. Sci. Res. 3 (3):85-93.
	In article
[20]	Awaad, M.H.H.; Hatem. M.H.; Abd El-Ghany, W.A.; El-Sawy, A.(2011).Certain Epidemiological Aspects of Aeromonas hydrophila Infection in Chickens. Journal of American Science.
	In article
[21]	Naharro, G.; Riano, J.; de Castro, L.; Alvarez, S.; Luengo, J.M. (2009). Aeromonas: Molecular Detection of Foodborne Pathogens (Liu D. Ed.). CRC Press. North Ryde, 273-289.
	In article
[22]	Cardinale, E.; Dromigny, J.A.; Tall, F.; Ndiaye, M.; Konte, M.; Perrier-GrosClaude, J.D. (2003). Fluoroquinolone susceptibility of Campylobacter. strains, Senegal. Emerg. Infect. Dis. 9(11): 1479-1481.
	In article		CrossRef
[23]	Osano, O.; Arimi, S.M. (1999). Retail poultry and beef as sources of. Campylobacter jejuni. East Afr. Med. J. 76(3): 141-3.
	In article
[24]	Obi, C.L.; Ramalivhana,J.; Samie,A., and Igumbo,E.O.(2007). Prevalence, pathogenesis antibiotic susceptibility profiles, and in-vitro activity of selected medicinal plants against Aeromonas isolates from stool samples of patients in the Venda region of South Africa. Journal of health population nutrition.
	In article
[25]	AL-Mojmae, I.J.K.(2002). Ecological and Physiological study of Aeromonas hydrophila and role Enterotoxin in pathogenicity. M.Sc. Thesis, College of sciences, University of Baghdad. In Arabic.
	In article
[26]	AL-Agaide, R.S.A.(2002). A study of some characteristics and immunological effects of Aeromonas hydrophila enterotoxin. M.Sc. Thesis, College of sciences, University of Baghdad. In Arabic.
	In article
[27]	Ali, H.S.A.(2008). Studying the Crude growth extract effect of Aeromonas hydrophila on normal and cancer cell lines. M.Sc. Thesis, College of science, university of Kufa. In Arabic
	In article
[28]	Janda, J.M. & Abbott, S.L. (2010). The genus Aeromonas, taxonomy, pathogenicity, and infection. Clinical Microbiology Reviews 23, pp. 35-73.
	In article		CrossRef
[29]	Janda, J. M., and S. L. Abbott.(1998). Evolving concepts regarding the genus Aeromonas: an expanding panorama of species, disease presentation, and unanswered questions. Clin. Infect. Dis. 27: 332-344.
	In article		CrossRef
[30]	Rabaan, A. A.; Gryllos, I.;Tomas, J.M., and Shaw,J.G.(2001). Motility and the polar flagellum are required for Aeromonas caviae adherence to HEp-2 cells. Journal of Infection and Immunity 69(7): 4257-4267.
	In article		CrossRef
[31]	Kirov, S. M.; Tassell,B.C.; Semmler, A.B.T.; O’Donovan, L.A.; Rabaan,A.A. and Shaw, J.G.(2002). Lateral flagella and swarming motility in Aeromonas species. J. Bacteriol. 184: 547–555.
	In article		CrossRef
[32]	Kirov, S.M.; Castrisios, M.and Shaw, J.G.(2004). Aeromonas flagella (polar and lateral) are enterocyte adhesins that contribute to biofilm formation on surfaces. Infect. Immun. 72:1939-1945.
	In article		CrossRef
[33]	Kadhim, S.A.(2009). Detection of some bacterial causes of watery diarrhea in the province of Baghdad and some northern governorates, with a study of pathological effects. M.Sc.Thesis, College of Science, University of Baghdad. In Arabic.
	In article
[34]	Jayaraman, S.; Illanchezian, S.; Manoharan, M.S. and Valsalam, S. (2010).Virulence and cytotoxicity of seafood borne Aeromonas hydrophila. Food Microbiology. Brazilian Journal of Microbiologyversion SSN 1517-8382.
	In article
[35]	Rahim Z, Sanyal SC, Aziz KMS, Huq MI, Chowdhury AA (1984).Isolation of enterotoxigenic, hemolytic and antibiotic-resistant Aeromonas hydrophila strains from infected fish in Bangladesh. Appl.Environ. Microbiol., 48: 865-867.
	In article
[36]	Yogananth, N.; Bhakyaraj, R.; Chantchuru, A.; Anbalagan, T.; Mullai Nila, K. (2009). Detection of virulence gene in Aeromonas hydrophila isolated from fish samples using PCR technique. Global J. Biotechnol. Biochem., 4, 51–53.
	In article
[37]	Abrami, J.; Firaz, M. and Good, V.F.G.(2000). Surface dynamics of aerolysin on the plasma membrane of living cells. Int.J. Med. Microbid. 290(4-5): 363-367.
	In article		CrossRef
[38]	Al-Taee, R. K.I.(2002). Study of some virulence factors of the Aeromonas hydrophila bacteria isolated from clinical source. M.Sc. Thesis, College of science, University of Baghdad. In Arabic.
	In article
[39]	Pandey,A.; Naik,M.; Dubey,S.K.(2010). Hemolysin, Protease, and EPS Producing Pathogenic Aeromonas hydrophila Strain An4 Shows Antibacterial Activity againstMarine Bacterial Fish Pathogens. Laboratory of Bacterial Genetics and Environmental Biotechnology, Department of Microbiology, Goa University, Taleigao Plateau, Goa, 403206, India.
	In article
[40]	Trower, C.J. Abo, S.; Majeed, K.N. and Itzstein, M.V.(2000). Production an enterotoxin by a gastro- enteritis associated Aeromonas strain. J. Med. Microbiol. 49:121-126.
	In article
[41]	Janda, J. M.( 2001). Chapter 59. Aeromonas and Plesiomonas, p. 1237-1270. In M. Sussman (ed.), Molecular medical microbiology, vol. 2. Academic Press, London, United Kingdom.
	In article		CrossRef
[42]	Wang, G.; Clifford, C.G.; Liu, C.; Pucknell, C.; Munro, C.K.; Kruk, T.M.; Caldeira, R.; Woodward, D.L., and Rodgers, F.G.(2003). Detection and characterization of a hemolysin gene in Aeromonas hydrophila and Aeromonas sobria by multiplex PCR. J Clin Microbiol 41:1048-1054.
	In article		CrossRef
[43]	Wilcox, M.H.; Jones, B.L. (1995). Aeromonas infections and their treatment. J Antimicriob chemother. 1995; 35: 453-416.
	In article