Staphylococcus aureus (S.aureus) is the most common pathogen found in hospitals, community-acquired infections and colonizes up to 50% of humans, including mucous membranes and damaged skin. Some strains produce enterotoxins (Ent) as staphylococcal enterotoxin A (SEA) which is involved in 75% of food poisoning outbreaks. Few methods are sensitive and specific enough to confirm the diagnosis of staphylococcal food poisoning. In this study, a segment of Ent A-ORF with molecular weight 774 bp was amplified, cloned, sequenced and aligned with published Ent A-ORFs. Ent A-ORF was subcloned into bacterial expression vector (GST-PGEX4T1 vector) and expressed as a fusion protein with GST-tagged protein. A band size of 27 kDa of purified Ent A protein was cleaved from GST protein by thrombin. The expressed protein of Ent A was identified by strong reaction with commercialized polyclonal antibodies against Ent A. Antiserum against Egyptian recombinant Ent A protein was produced by immunization of Balb/c mice, the produced recombinant polyclonal antibodies had a titre of 1:2500 in direct ELISA. The produced recombinant polyclonal antibody was evaluated and reacted specifically in Western immunoblotting analysis and ELISA test. Finally from the obtained results, the produced recombinant protein of Ent A can be used successfully for production of recombinant polyclonal antibodies and used in large-scale detection of staphylococcal enterotoxin A.
Staphylococcal enterotoxins (SEs) are the second most common causal agents of food poisoning and clinical infections throughout the world 1, 2. Therefore, its paramount importance to use quick, accurate and sensitive methods for detecting them. For developing of an effective immunodetection system, availability of sensitive and specific antibodies against SEs is the major bottleneck.
There are over 30 species of identified staphylococci, and they are typically found on the skin and mucous membranes of mammals. About a dozen species are frequently carried on humans, including Staphylococcus aureus, S. epidermidis, S. haemolyticus, S. capitis, S. hominis, S. cohnii, S. lugdunensis, S. schleiferi, S. saprophyticus, S. simulans, S. warneri and S. xylosus. All these species are capable of causing disease in humans, but S. aureus is by far the most aggressive pathogen and is the species most commonly implicated in food poisoning 3. Therefore, this work focused on enterotoxin A from S. aureus.
S. aureus are differentiated from other staphylococci in the diagnostic laboratory by their ability to coagulate plasma. S. aureus also encode and produce a wide range of toxins, immune escape mechanisms and other virulence factors and are becoming increasingly resistant to antibiotics. They are a major cause of hospital-acquired infection and an increasing cause of veterinary infection and are a common cause of mastitis in dairy cows. It is also a common cause of food poisoning, due to bacterial staphylococcal enterotoxins (SEs) that are heat resistant. Because symptoms usually resolve within 24 hours without treatment, it is likely that most cases remain undiagnosed or unreported. Carriage of SE genes varies widely between S. aureus strains, and some enterotoxins are more commonly associated with food poisoning than others 4.
Enterotoxins are a very common cause of food poisoning; S. aureus is so ubiquitous that food storage and handling must be carefully controlled to prevent S. aureus growth and toxin production. A wide range of SE toxins are produced by S. aureus that are capable of causing vomiting, and each is distributed amongst S. aureus strains differently, they regulated differently and can transfer between strains on different types of genetic elements. The robustness of the organism permits its growth in many types of food, producing enterotoxins subsequently causing food poisoning. The bacteria can be killed through heat treatment of the food, but the enterotoxins are very heat resistant. Thus, although the bacteria are eliminated, the toxins will remain and can cause food poisoning 5.
Detection methods of enterotoxins are not very sensitive, and live S. aureus are not necessarily found in contaminated food, but improved methods are being developed 6. In the future, new toxins may be discovered, detection methods should become more sensitive and hopefully more may become known about factors that control S. aureus spread and toxin production in food.
In this study, we produced of Egyptian staphylococcal enterotoxin A protein as a purified recombinant toxin and used it as an antigen to produce polyclonal antibodies for developing a sensitive and reliable diagnostic ELISA kit for Ent A detection.
The bacterial DNAs were extracted from the positive control (S.aureus strain ATCC number 9128 was used as reference strain) and positive tested sample SA 41 (sample 41 was published in 7 that were used as a template in PCR) and the two specific primers for Ent A gene as follows:
Ent A-F:
5’CGGGATCCATGAAAAAAACAGCATTTACA’3
Ent A–R:
5’CCGCTCGAGTTAACTTGTATATAAATATATAT’3.
The bold letters represent Bam H1 and Xhol restriction sites in the Ent A-Forward (Ent A-F) and Ent A-Reverse (Ent A-R), respectively. Ent A-F and Ent A–R were designed based on the published Ent A sequence of 8. All used primers were synthesized by Biosearch Technologies (US & Canada).
PCR was conducted in a volume of 50 µl containing, 1X reaction buffer with MgSO4, 200 μM each dNTPs (dATP, dTTP, dCTP and dGTP), 0.4 pmol of each primer, 0.025 units of Pfu DNA polymerase, template and d.d.H2O. PCR was performed in a Perkin-Elmer (Gene Amp PCR System 2400) for 35 cycles after initial denaturation for 10 min at 95°C. Each cycle consisted of denaturation at 95°C for 35 sec, annealing at 55°C for 1 min, extinsion at 72°C for 1 min. The primer extension was extended to 7 min at 72°C in the final cycle. Amplified fragment of the Ent A gene separated using 1.2% (w/v) agarose gel electrophoresis. The PCR amplified product was detected by electrophoresing on 1.2% agarose gel in 1X TAE buffer at 80 volts for one hour 9.
2.2. Cloning of Ent A gene in pGEM-T Easy VectorPost PCR amplification, 25 μl from the PCR product was heated at 95°C for 20 min, 7.5 μl dATP (from a 2 mM stock), 1.5 μl MgCl2 (from a stock 50 mM) and 1 μl (0.5 Unit) of Taq DNA polymerase were added, and the mixture was incubated at 70°C for 15 min. Wizard® DNA Clean-Up System kit (Thermo Scientific #K0691) was used to purify the PCR product after A-tailing. A-tailed PCR fragment was ligated into the pGEM-T easy vector in a volume of 20 μl. Competent cells of E. coli (strain JM 109) were prepared using CaCl2 as described by 10. The method of transformation was carried out as described by 11. The Wizard® plasmid mini-preparation system from Promega was used to isolate pure super-coiled plasmid DNA with high yields. The PCR product was cloned into pGEM-T Easy vector to create the plasmid pNH1(pGEM-T easy vector +Ent A-ORF) that introduced into E. coli strain GC5. After mini-preparation, the purified plasmid DNA was subjected to digestion with the restriction endonucleases BamHI and XhoI and PCR detection.
2.3. Sequence Analysisfter confirmation, DNA of a recombinant clone pNH1 was sequenced using F and R T7 pGEM universal primers (Eurofins Scientific, Germany).
The NCBI online BLAST tool was used to align the generated sequences using BLAST algorithm 12 against the NCBI database. PERL scripts were used to visualize BLAST results using Circos software package (Circos 0.66) 13. Multiple Sequence Alignment using T-Coffee. Multiple Sequence Alignment online Tools was used to obain Percent Identity Matrix Alignment (http://www.tcoffee.org/Projects/tcoffee/).
Protein structure homology modeling has become a routine technique to generate 3D models for proteins. SWISS-MODEL and Phyre2 were used in this study for protein modeling and structure. SWISS-MODEL (http://swissmodel. expasy.org/) is an automated system for modeling the 3D structure of a protein from its amino acid sequence using homology modeling techniques 14. Each model built by Phyre2 is based on an alignment generated by HMM-HMM matching 15.
2.4. Expression of Ent A Gene Using PGEX SystemA according to the manual instructions of GST Gene Fusion System Handbook (GE Healthcare life Science), the sequenced clone was digested with BamHI and XhoI restriction endonuclease enzymes and the released fragment was subcloned into PGEX4T1 vector that was previously digested with the same restriction enzymes, and the obtained plasmid designated pNH2. After ligation, plasmid was transformed into E.coli strain BL21. The recombinant plasmid was screened under two different concentrations from IPTG (1 and 0.1 mM) at different incubation times (1, 2, 3hr and overnight respectively at 37°C and 16°C). The protein(s) was determined using 12% SDS-PAGE.
2.5. Detection of Expressed Ent A Protein Using Western Blotting AnalysisIn this experiment, western blot technique was used as described by 16. The total proteins were extracted from transformed and non-transformed E. coli, electrophoresed on 12% SDS-PAGE and blotted onto membrane ((Immobilon ® PVDF membrane, Millipore cooperation, Bed ford, MA 01730) using a trans-blot apparatus (Bio-Rad). After blocking with 5% bovine serum albumin, the membrane was treated with appropriate dilutions enterotoxin A antibody as primary antibody (commercialized polyclonal antibodies against Ent A, product No.S7656, USA). Membrane was washed with TBS-T/Triton buffer and then alkaline phosphatase (ALP)-conjugate (goat anti-rabbit IgG Sigma Cat# A-3562) was added in a dilution of 1:30000 (in conjugate buffer) to the membranes and incubated for 1 hr at RT with gently shaking. After washing the color reaction was started by incubating the membranes in BCIP/NPT in substrate buffer and the membrane was left until the desired bands appeared. The reaction was stopped by washing the membranes with double d.H2O (d.d. H2O) for several times. The membrane was air dried on a filter paper and photographed.
2.6. Production and Purification of the GST- Tagged Fusion ProteinAfter expression and confirmation process, the purification steps was carried out in large scale by using GST bulk kit (from GE-Healthcare Bio-science AB # cat. No. 27457001) and finally analyzed by SDS-PAGE 9.
According to the manual instructions of GST Gene Fusion System Handbook (GE Healthcare life Science), the recombinant protein of Ent A was separated from GST protein by Thrombin enzyme. Total protein was determined using Pierce™ BCA Protein Assay Kit (Thermo fisher Cat # 23225) with BSA as standard for quantizations of the total protein.
2.7. Production of Polyclonal AntibodyAntiserum was raised against expressed Ent A protein by injecting two balb/c mice with the purified Ent A protein. The sequence of doses was 10, 10, and 5μg recombinant SEA 17. Ent A were emulsified with an equal volume of freund's complete adjuvant and injected Intraperitoneal for the first and incomplete adjuvents for the second two subsequent intramuscular injections at weekly intervals. After immunizations, the immune responses of the mice were measured by indirect ELISA. The blood was collected at weekly intervals 4 weeks post of the first injection followed by incubation at 37°C for 1 h and low centrifugation (4000 rpm) at RT. The antiserum was collected and stored at 4°C until required. The IgGs concentration was then adjusted to 1 mg/ml (A280 nm = 1.46, Clark and Adams, 1977) and stored at –20°C until required. IgGs were conjugated with ALP according to the protocol given by 18, 19. The double antibody sandwich (DAS)-ELISA 20, 21 was used to determine titer of antiserum.
2.8. Determination the Specificity and Sensitivity of the Produced AntibodiesThe specificity and sensitivity of the produced IgGs against recombinant Ent A protein were determined by western blotting as described by 16 using the produced recombinant IgGs as a polyclonal antibodies.
The bacterial DNAs from the positive control and positive ELISA tested sample (sample 41) were used as a template in PCR and the amplified interested gene was 774 bp and were detected in both samples (Figure 1).
The dsDNA PCR product was cloned into pGEM-T Easy vector to create the plasmid and putative clone was designated pNH1 (Figure 2) that was transformed into E. coli strain GC5.
After mini-preparation, the purified plasmid DNAs were subjected to digestion with BamHI and XhoI as a confirmatory test, a segment of about 774 bp (Figure 3) were released from all recombinant plasmids.
After confirmation, DNA of a recombinant clone pNH1 was sequenced. In Figure 4, the nucleotide sequences of Ent A gene of Egyptian isolate of staphylococcus aureus was 774bp nucleotides with one open reading frame (Accession No. NAGAH1 KX777250).
Depending upon the resulted sequencing data of SA-41 isolate, these readings were aligned with NCBI Basic Local Alignment Search Tools (BLASTs). The Ent A of the Egyptian isolate (SA-41) gave a high sequence similarities with Ent A genes belonging to different isolates of S. aureus and the similarities were ranged 91-100% based on nucleotide sequences (Figure 5).
The sequenced clone was digested with BamHI and Xho1 restriction endonuclease enzymes and the released fragment was subcloned into PGEX4T1 vector that was previously digested with the same restriction enzymes, and the obtained plasmid designated pNH2 (Figure 6).
The plasmid pNH2 was transformed into E.coli BL 21 and was induced by adding IPTG. The best condition for Ent A protein expression was 0.1mM IPTG at 16°C for overnight incubation. The expressed protein was 53 KDa (26 KDa represents GST tagged protein and 27 KDa represent Ent A recombinant protein).
The Ent A recombinant protein for both reference strain and SA-41 strain were purified by GST purification protocol. SDS-PAGE revealed a purified expressed protein at 53 KDa (Figure 7).
In Figure 8A, the fusion protein (53KDa) was digested with Thrombine enzyme to separate GST tagged protein (26 KDa) from expressed Ent A protein (27 KDa).
The specificity of the produced expressed fusion protein was determined by Western blotting analysis (Figure 8B). The commercialized polyclonal antibodies against Ent A was reacted strongly and specifically with 27 KDa protein band in both samples (reference and sample 41). This result indicated that the produced recombinant protein of Ent A can be used successfully in production of polyclonal antibodies with high specificity and sensitivity.
After protein expression, purification and cleavage procedures, the yield of recombinant Ent A protein was 0.5mg/100ml of culture medium. Antiserum was raised against Ent A protein, and the produced polyclonal antibodies was purified and IgGs concentration was determined by ELISA and adjusted to 1 mg/ml. Following that, IgGs were conjugated with the Alkaline phosphatase. DAS-ELISA results revealed that the titer of IgG was 1:2500. The titer was calculated according to the signal in ELISA with Ent A which should be at least 2 fold higher than the signal produced with negative Ent A producing isolates (Table 1).
The sensitivity and specificity of the produced recombinant IgG was tested by Western blotting analysis using the protein extracts of E. coli strain BL21, pGEX4T1 vector (transformed in E. coli BL21) as negative control, positive control (Ent A protein), recombinant Ent A protein and crude extracts of culture of three Staphylococcus aureus local strains produce Ent A protein. Western blotting analysis revealed that the recombinant IgG reacted specifically with a protein of about 27 kDa present in the induced culture of E. coli harbouring plasmid pNH2 and positive control. Moreover, the recombinant polyclonal antibodies also reacted specifically with the 27 kDa of other Ent A produced from local strains as well as the purified fusion protein(s) (Figure 9 and Figure 10). This interested band seem to be absent in other extract of BL21 lysate and GST protein.
The purpose of this study is to prepare antigenic recombinant protein of Ent A and used as an antigen for producing recombinant polyclonal antibody. In this study, PCR amplification for target Ent A gene was followed by sequencing to recognize length of interested gene and its nucleotide sequence, this experiment clarified that Ent A gene was 774 bp. This result is in harmony with 21 who found that coding sequence for Ent A is contained in an open reading frame of 774 base pairs and contained 258 codons, including the translation initiation and termination codons.
The BLAST analysis of the nucleotide sequence gave another good proof that the Ent A gene of Egyptian isolate SA-41 is belonging to Ent A genes.
Measuring of similarity matrix between strain SA-41 (Egyptian isolate) and published different isolates showed identity 99% and 100% for transcription level (amino acid sequence level) which indicated absence of mutation, but may be due to short genetic variations SNP (single nucleotide polymorphism) is possible. Similar results were reported by 8, 22.
After amplification, cloning and sequencing of Ent A gene, the Ent A gene was constructed to PGEX4T1 bacterial expression vector. The Ent A gene was expressed under the control of tac promoter which is induced by IPTG. It is worthy that the best condition for Ent A protein expression was 0.1mM IPTG at 16°C for overnight incubation. The expressed protein was analyzed by SDS-PAGE and the presence of a band with a molecular mass of approximately 53 KDa (the expected size for the GST tagged protein 26 KDa and Ent A recombinant protein 27 KDa). The recombinant protein of Ent A was separated from fusion partner GST tagged protein by using Thrombin enzyme.
After expression and purification of the recombinant protein, the concentration of purified recombinant protein was 0.5 mg/100 ml of culture medium. The identity of the expressed fusion protein was confirmed by Western blotting analysis using commercialized polyclonal antibodies against Ent A, Western blot revealed a strong band at 27 KDa band of Ent A recombinant protein.
The expressed fusion protein of Ent A can be produced in large quantities and avoid the difficulties of staphylococcal growth and toxin production. It can be applied successfully for production of polyclonal antibodies free from any contaminant-derived immunogens.
The recombinant polyclonal antibodies were produced against expressed protein of Ent A and DAS-ELISA test was used to determine an optimal concentration from IgG for the detection of Staphylococal Ent A. DAS-ELISA results revealed that the titer of IgG was 1:2500. ELISA method has proved their great worth in detection of S. aureus because it is rapid, inexpensive and does not require special skills.
The sensitivity and specificity of recombinant polyclonal antibody was tested by Western blotting analysis, the results were revealed that the produced IgG was reacted specifically with a protein of about 27 kDa present in the induced culture of E. coli harbouring plasmid pNH2 and positive control. Moreover, the antiserum also reacted with Ent A protein produced from local strains as well as the purified fusion protein(s). This interested band seem to be absent in other extracts of BL21 lysate and GST.
Fusion protein technology has been applied to improve antigen expression in bacterial host and also to increase the quality of the produced polyclonal antibodies. The ability to express and purify the desired recombinant protein in a large quantity allows for its use in the development of Egyptian diagnostic kits and to limit importation from other countries. A availability of local diagnostic ELISA kit will facilitate testing large number of food samples, such as meat, milk and other food products, in food industries and agricultural Quarantine. This kit also will contribute in food safety program via improving the quality control of food production.
This work was supported financially by the Science and Technology Development Fund (STDF), Egypt, Grant No; 4405.
| [1] | Agrawal, R., Singh, P.K., Sharma, S.K., Kamboj, D.V., Goel, A.K., & Singh, L. (2012). “Highly Expressed Recombinant SEB for Antibody Production and Development of Immunodetection System,” Indian J. Microbiol., 52(2): 191-196. | ||
| In article | View Article PubMed | ||
| [2] | Rasooly, R., Do, P., & Hernlem., B. (2016). “Sensitive, Rapid, Quantitative and in Vitro Method for the Detection of Biologically Active Staphylococcal Enterotoxin Type E. Toxins,” 8, 150. | ||
| In article | View Article PubMed | ||
| [3] | Wiedmann, M. & Zhang, W. (2013). “Genomics of Foodborne Bacterial Pathogens,” Springer New York Dordrecht Heidelberg London. ISBN 978-1-4419-7685-7. | ||
| In article | View Article | ||
| [4] | Pinchuk, I.V., Beswick, E.J. & Reyes, V.E. (2010). “Staphylococcal enterotoxins,” Toxins, (Basel), 2: 2177-2197. | ||
| In article | View Article PubMed | ||
| [5] | Le Loir Y, Baron F, Gautier M. (2003). “Staphylococcus aureus and food poisoning,” Genet. Mol. Res, 2: 63-76. | ||
| In article | PubMed | ||
| [6] | Rall, V.L.M., Sforcin, J.M., Augustini, V.C.M., Watanabe, M.T., Fernandes Jr., A., Rall, R., Silva, M.G., & Araújo, Jr.J.P. (2010). “Detection of enterotoxin genes of Staphylococcus sp. Isolated from nasal cavities and hands of food handlers,” Braz. J. Microbiol., 41: 59-65. | ||
| In article | View Article PubMed | ||
| [7] | Hussein, H.A., Ibrahim, M.K., Nour El-Din, H.A., El-Shatoury, E.H., El-Fouly, M. E., Abd-Eal, S.S. & Abu El-Naga, M.N. (2016). “Molecular Screening of Staphylococcal Enterotoxin Type A Encoding Gene from MRS Clinical Isolates,” American Journal of Microbiological Research, 4 (2): 68-72. | ||
| In article | View Article | ||
| [8] | Chen, L., Li, S., Wang, Z., Chang, R., Su, J. & Han, B. (2012). “Protective effect of recombinant staphylococcal enterotoxin A entrapped in polylactic-co-glycolic acid microspheres against S. aureus infection,” Veterinary Research, 43(1): 20. Available at: http://www.veterinaryresearch.org/content/43/1/20. | ||
| In article | View Article PubMed | ||
| [9] | Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989). “Molecular Cloning”: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor New York. | ||
| In article | |||
| [10] | Hammond, J. & R. W. Hammond (1989). “Molecular cloning, sequencing and expression in Escherichia coli of the bean yellow mosaic virus coat protein gene. Journal of General Virology 70:1961-1974. | ||
| In article | View Article PubMed | ||
| [11] | Hanahan, D. & M. Meselson (1983). “In Methods in Enzymology,” Vol. 100, Wu. et al. (eds), Acad. Press. NY, p. 333. | ||
| In article | |||
| [12] | Altschul, S.F., Boguski, M.S., Gish, W. & Wootton, J.C. (1994). “Issues in searching molecular sequence databases,” Nat Genet. 6(2):119-29. | ||
| In article | View Article PubMed | ||
| [13] | Krzywinski, M., Schein, J., Birol, I., Connors, J., Gascoyne, R., Horsman, D., Jones, S.J. and Marra, M.A. (2009). “Circos: an information aesthetic for comparative genomics,” Genome Res., 19(9):1639-45. | ||
| In article | View Article PubMed | ||
| [14] | Kelley, L.A. & Sternberg, M.J E. (2009). Protein structure prediction on the web: a case study using the Phyre2 server,” Journal of Nature Protocols, 4: 363-371. | ||
| In article | View Article PubMed | ||
| [15] | Marco, B., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F., Cassarino, T. G., Bertoni, M., Bordoli, L. & Schwede, T. (2014). “SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information,” Nucleic Acids Res., 42 (1): 252-258. | ||
| In article | View Article | ||
| [16] | Towbin H, Staehelin T, & Gordon J. (1979). “Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications,” Proc. Natl. Acad. Sci. USA, 76(9): 4350-4. | ||
| In article | View Article PubMed | ||
| [17] | Kuang, H., Wang, W., Xu, L., Ma, W., Liu, L., Wang, L. & Xu, C. (2013). “Monoclonal antibody-based sandwich ELISA for the detection of staphylococcal enterotoxin A,” Int. J. Environ. Res. Public Health, 10:(4) 1598-608. | ||
| In article | View Article PubMed | ||
| [18] | Avrameas, S. (1969). “Coupling of enzymes to proteins with glutaraldehyde.” Immunochemistry, 6: 43-52. | ||
| In article | View Article | ||
| [19] | Clark, M.F. & A.N. Adams (1977). “Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses, ” J. Gen. Virol., 34: 475-483. | ||
| In article | View Article PubMed | ||
| [20] | McLaughlin, M.R., Barnett, O.W., Gibson, P.B. & Burrows, P.M. (1984). “Enzyme linked immunosorbent assay of viruses infecting forage legumes, ” Phytopathology 74: 965-969. | ||
| In article | View Article | ||
| [21] | Betley, M.J. & Mekalanos. J.J. (1988). “Nucleotide sequence of the type A staphylococcal enterotoxin gene,” J. Bacteriol. 170(1): 34-41. | ||
| In article | View Article PubMed | ||
| [22] | Weir, D., Jones, C., Ammerman, L., Dybdahl, K. & Tomlinson, S. (2007). “Report of a strain of Staphylococcus caprae with the genes for enterotoxin A and enterotoxin-like toxin type P,” J. Clin. Microbiol., 45 (10): 3476-3477. | ||
| In article | View Article PubMed | ||
Published with license by Science and Education Publishing, Copyright © 2017 H. A. Nour El-Din, M. N. Abu El-Naga, M. E. El-Fouly, M. K. Ibrahim, E. H. El-Shatoury and H. A. Hussein
This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/
| [1] | Agrawal, R., Singh, P.K., Sharma, S.K., Kamboj, D.V., Goel, A.K., & Singh, L. (2012). “Highly Expressed Recombinant SEB for Antibody Production and Development of Immunodetection System,” Indian J. Microbiol., 52(2): 191-196. | ||
| In article | View Article PubMed | ||
| [2] | Rasooly, R., Do, P., & Hernlem., B. (2016). “Sensitive, Rapid, Quantitative and in Vitro Method for the Detection of Biologically Active Staphylococcal Enterotoxin Type E. Toxins,” 8, 150. | ||
| In article | View Article PubMed | ||
| [3] | Wiedmann, M. & Zhang, W. (2013). “Genomics of Foodborne Bacterial Pathogens,” Springer New York Dordrecht Heidelberg London. ISBN 978-1-4419-7685-7. | ||
| In article | View Article | ||
| [4] | Pinchuk, I.V., Beswick, E.J. & Reyes, V.E. (2010). “Staphylococcal enterotoxins,” Toxins, (Basel), 2: 2177-2197. | ||
| In article | View Article PubMed | ||
| [5] | Le Loir Y, Baron F, Gautier M. (2003). “Staphylococcus aureus and food poisoning,” Genet. Mol. Res, 2: 63-76. | ||
| In article | PubMed | ||
| [6] | Rall, V.L.M., Sforcin, J.M., Augustini, V.C.M., Watanabe, M.T., Fernandes Jr., A., Rall, R., Silva, M.G., & Araújo, Jr.J.P. (2010). “Detection of enterotoxin genes of Staphylococcus sp. Isolated from nasal cavities and hands of food handlers,” Braz. J. Microbiol., 41: 59-65. | ||
| In article | View Article PubMed | ||
| [7] | Hussein, H.A., Ibrahim, M.K., Nour El-Din, H.A., El-Shatoury, E.H., El-Fouly, M. E., Abd-Eal, S.S. & Abu El-Naga, M.N. (2016). “Molecular Screening of Staphylococcal Enterotoxin Type A Encoding Gene from MRS Clinical Isolates,” American Journal of Microbiological Research, 4 (2): 68-72. | ||
| In article | View Article | ||
| [8] | Chen, L., Li, S., Wang, Z., Chang, R., Su, J. & Han, B. (2012). “Protective effect of recombinant staphylococcal enterotoxin A entrapped in polylactic-co-glycolic acid microspheres against S. aureus infection,” Veterinary Research, 43(1): 20. Available at: http://www.veterinaryresearch.org/content/43/1/20. | ||
| In article | View Article PubMed | ||
| [9] | Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989). “Molecular Cloning”: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor New York. | ||
| In article | |||
| [10] | Hammond, J. & R. W. Hammond (1989). “Molecular cloning, sequencing and expression in Escherichia coli of the bean yellow mosaic virus coat protein gene. Journal of General Virology 70:1961-1974. | ||
| In article | View Article PubMed | ||
| [11] | Hanahan, D. & M. Meselson (1983). “In Methods in Enzymology,” Vol. 100, Wu. et al. (eds), Acad. Press. NY, p. 333. | ||
| In article | |||
| [12] | Altschul, S.F., Boguski, M.S., Gish, W. & Wootton, J.C. (1994). “Issues in searching molecular sequence databases,” Nat Genet. 6(2):119-29. | ||
| In article | View Article PubMed | ||
| [13] | Krzywinski, M., Schein, J., Birol, I., Connors, J., Gascoyne, R., Horsman, D., Jones, S.J. and Marra, M.A. (2009). “Circos: an information aesthetic for comparative genomics,” Genome Res., 19(9):1639-45. | ||
| In article | View Article PubMed | ||
| [14] | Kelley, L.A. & Sternberg, M.J E. (2009). Protein structure prediction on the web: a case study using the Phyre2 server,” Journal of Nature Protocols, 4: 363-371. | ||
| In article | View Article PubMed | ||
| [15] | Marco, B., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F., Cassarino, T. G., Bertoni, M., Bordoli, L. & Schwede, T. (2014). “SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information,” Nucleic Acids Res., 42 (1): 252-258. | ||
| In article | View Article | ||
| [16] | Towbin H, Staehelin T, & Gordon J. (1979). “Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications,” Proc. Natl. Acad. Sci. USA, 76(9): 4350-4. | ||
| In article | View Article PubMed | ||
| [17] | Kuang, H., Wang, W., Xu, L., Ma, W., Liu, L., Wang, L. & Xu, C. (2013). “Monoclonal antibody-based sandwich ELISA for the detection of staphylococcal enterotoxin A,” Int. J. Environ. Res. Public Health, 10:(4) 1598-608. | ||
| In article | View Article PubMed | ||
| [18] | Avrameas, S. (1969). “Coupling of enzymes to proteins with glutaraldehyde.” Immunochemistry, 6: 43-52. | ||
| In article | View Article | ||
| [19] | Clark, M.F. & A.N. Adams (1977). “Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses, ” J. Gen. Virol., 34: 475-483. | ||
| In article | View Article PubMed | ||
| [20] | McLaughlin, M.R., Barnett, O.W., Gibson, P.B. & Burrows, P.M. (1984). “Enzyme linked immunosorbent assay of viruses infecting forage legumes, ” Phytopathology 74: 965-969. | ||
| In article | View Article | ||
| [21] | Betley, M.J. & Mekalanos. J.J. (1988). “Nucleotide sequence of the type A staphylococcal enterotoxin gene,” J. Bacteriol. 170(1): 34-41. | ||
| In article | View Article PubMed | ||
| [22] | Weir, D., Jones, C., Ammerman, L., Dybdahl, K. & Tomlinson, S. (2007). “Report of a strain of Staphylococcus caprae with the genes for enterotoxin A and enterotoxin-like toxin type P,” J. Clin. Microbiol., 45 (10): 3476-3477. | ||
| In article | View Article PubMed | ||