Topoisomerases II Mutations in Ciprofloxacin-resistant Clinical Isolates of Pseudomonas aeruginos...

Irene E.Rieuwpassa, Ressy Dwiyanti, Yadi Yasir, Muhammad Sabir, Mochammad Hatta

  Open Access OPEN ACCESS  Peer Reviewed PEER-REVIEWED

Topoisomerases II Mutations in Ciprofloxacin-resistant Clinical Isolates of Pseudomonas aeruginosa in Makassar, Indonesia

Irene E.Rieuwpassa1, Ressy Dwiyanti2, 3, Yadi Yasir4, 3, Muhammad Sabir2, 3, Mochammad Hatta3,

1Department of Oral Biology, Faculty of Dentistry, Hasanuddin University, Makassar, Indonesia

2Department of Microbiology, Faculty of Medicine, Tadulako University, Palu, Indonesia

3Department of Microbiology, Molecular Biology and Immunology Laboratory, Facculty of Mediciene, Hasanuddin University, Makassar, Indonesia

4Department Microbiology and Immunology, Faculty of Medicine, Mulawarman University, Samarinda, Indonesia

Abstract

Background: Ciprofloxacin constitute a clinically successful and widely used class of broad-spectrum antibiotics; however, the emergence and spread of resistance increasingly limits the use of this fluoroquinolone in the treatment and management of microbial disease. Ciprofloxacin is the most frequently used member of the fluoroquinolones during initial eradication therapy of Pseudomonas aeruginosa. The emergence of ciprofloxacin-resistant Pseudomonas aeruginosa (P. aeruginosa) has been reported. In this study, we examined mutations in the quinolone resistance-determining regions of the topoisomerase II (GyrA) genes of 11 clinical isolates of P. aeruginosa that resistance to ciprofloxacin. Methods: In this study we examined the relationship between gene mutations of topoisomerase II (gyrA) with ciprofloxacin resistance of P. aeruginosa. The examination performed by disc diffusion test followed by RFLP-PCR. Results: The results of disc diffusion test showed that 13 samples were sensitive to ciprofloxacin, 11 samples were resistant to ciprofloxacin. In this study we found mutation in GyrA in 6 (54.5%) of ciprofloxacin resistant samples. There was no mutation found in ciprofloxacin sensitive samples. Conclusion: Mutation in topoisomerases genes are the main mechanism of fluoroquinolone resistance in P. aeruginosa.

At a glance: Figures

Cite this article:

  • E.Rieuwpassa, Irene, et al. "Topoisomerases II Mutations in Ciprofloxacin-resistant Clinical Isolates of Pseudomonas aeruginosa in Makassar, Indonesia." American Journal of Infectious Diseases and Microbiology 3.3 (2015): 91-94.
  • E.Rieuwpassa, I. , Dwiyanti, R. , Yasir, Y. , Sabir, M. , & Hatta, M. (2015). Topoisomerases II Mutations in Ciprofloxacin-resistant Clinical Isolates of Pseudomonas aeruginosa in Makassar, Indonesia. American Journal of Infectious Diseases and Microbiology, 3(3), 91-94.
  • E.Rieuwpassa, Irene, Ressy Dwiyanti, Yadi Yasir, Muhammad Sabir, and Mochammad Hatta. "Topoisomerases II Mutations in Ciprofloxacin-resistant Clinical Isolates of Pseudomonas aeruginosa in Makassar, Indonesia." American Journal of Infectious Diseases and Microbiology 3, no. 3 (2015): 91-94.

Import into BibTeX Import into EndNote Import into RefMan Import into RefWorks

1. Introduction

Fluoroquinolon was originally developed as an excellent activity against aerobic Gram-negative bacteria, while its activity against Gram-positive organisms is limited. Ciprofloxacin, enofloxacin, lomefloxacin, levofloxacin, ofloxacin are agents that have activity both Gram-negative and of moderate to good activity against Gram-positive bacteria. In this group, ciprofloxacin is the most active agents against Gram-negative, especially Pseudomonas aeruginosa [1, 2].

Ciprofloxacin is a second-generation agent, as one of the quinolones derivates. Ciprofloxacin inhibit the activity of bacterial DNA gyrase, it has bactericidal activity with a broad spectrum against Gram positive and Gram-negative. Ciprofloxacin effectively used for urinary tract infections, urethritis, typhoid and paratyphoid fever, respiratory infections, soft tissue infections and osteomyelitis. The drug can also be used as antimicrobial prophylaxis in patients with neutropenia [3].

Since the intensive use of ciprofloxacin as one of the most effective quinolones against P. aeruginosa, has led to the emergence of resistant strains [4]. The targets of quinolones are considered to be the type II topoisomerases, which are essential enzymes responsible for controlling the topological state of DNA during its replication and transcription. DNA gyrase is composed of two A and B subunits, which are encoded by the gyrA and gyrB genes [5]. Topoisomerases are play essential roles in every aspect of DNA metabolism [6, 7]. The quinolone antibiotics inhibit DNA replication by forming complexes of the drug with DNA bound to the topoisomerase enzyme [6]. Quinolones interfere with the activity of DNA gyrase, an essential bacterial type II DNA topoisomerase [8]. Many studies have been demonstrated that mutations conferring fluoroquinolone resistance in P. aeruginosa may be due to alterations in DNA gyrase, because of the reduced sensitivity to fluoroquinolone inhibition of DNA supercoiling in fluoroquinolone-resistant isolates and reduced inhibition of DNA synthesis by fluoroquinolone resistant isolates upon exposure to fluoroquinolones[9]. The gyrA mutations are the major mechanism of resistance to fluoroquinolones [10].

To characterize the prevalence of mutations in type II topoisomerase genes on ciprofloxacin resistance, we analyzed the gyrA gene of Pseudomonas aeruginosa isolates with resistance to ciprofloxacin.

2. Methods

2.1. Identification of P. aeruginosa

Specimens from the wound/ulcer, taken using a cotton stick. Specimens were inoculated into the Mac Conkey agar (MC) and incubated at a temperature of 35-37°C for 24 hours. The bacterial colonies on MC were confirmed by Gram staining test to find the Gram-negative rods then followed by biochemical tests to find non-fermenter bacteria. P. aeruginosa are non-fermenter, oxidase (+), (+/-), pyocyanin fluorescence (+), glucose (+), xylose (+), (+/-), mannitol lactose (-), maltose (-), 42°C (+), esculin (-), urea (+), D Nase (-), ONPG (-), indole (-), motility (+), flagella (1), H2S (-), N2 gas ¬ (+ / -), pigment (brown, green and fluorescence).

2.2. Disc Diffusion Test

The results obtained by measuring the resistance zone formed on the agar. Inhibition zone width compared with NCCLS standard tables in 1997, to determine the bacterial isolates of P. aeruginosa resistant, intermediate and sensitive.

2.3. Preparation of DNA

DNA was extracted from freshly collected culture of P. aeruginosa according to the diatom-guanidinium isothiocyanate (GuSCN) method. For the extraction of DNA from culture, a freshly colony of P. aeruginosa sample was mixed with 900 uL of lysis buffer (50 mM Tris-HCl, 5.25 M GuSCN, 20 mM EDTA, 0.1% Triton X-100) and centrifuged at 12,000 × g for 10 minutes. To obtain the DNA, samples were lysed by incubation for 15 minutes at 18°C and 20 uL of diatom suspension was added. The diatom containing the bound DNA was sedimented by centrifugation at 12,000 × g for 15 seconds. The diatom pellet was washed with washing buffer (5.25 M GuSCN in 0.1 M Tris-HCl, pH 6.4), rinsed with 70% ethanol and acetone, and dried by incubation at 56°C for 10 minutes. The pellet was mixed with 60 uLof10 mM Tris-HCl, pH 8.0, 1 mM EDTA buffer and the DNA was eluted by incubation at 56°C for 10 minutes. After sedimentation of the diatom by centrifugation, the supernatant was collected and stored at -20°C until PCR was performed [11].

2.4. PCR Amplification

Nucleotide sequence from Gene Bank, Pseudomonas aeruginosa gi:459928, accession L29417 were use for PCR amplification [12]. Amplification on a PCR machine at 35 cycles, each cycle of denaturation for 1 minute to do with the temperature 94°C, annealing for 1 min at 65°C for gyrase A and extension for 1 minute at 72°C. Primers used are: Gyrase A forward GACGGCCTGAAGCCGGTGCAC and Gyrase A reverse GCCCACGGCGATACCGCTGGA. Sac II enzyme used for restriction of target amplified PCR product. Amplification results were analyzed using electrophoresis.

3. Results

In this study we examined the relationship between gene mutations of topoisomerase II (gyrA) with ciprofloxacin resistance of P. aeruginosa. The examination performed by disc diffusion test followed by RFLP-PCR. The results of disc diffusion test showed that 13 samples were sensitive to ciprofloxacin with an average diameter of inhibition zone 28.31 mm. We also found 11 samples were resistant to ciprofloxacin with average of inhibition zone 8.91mm (Figure 1).

Figure 1. Disc diffusion test of P. aeruginosa
Figure 2. Electrophoresis results of Sensitive Samples (S1-S11) before the restriction
Figure 3. Electrophoresis results of Sensitive (S12 and S13) before the restriction
Figure 4. Electrophoresis results of resistant samples (R1-R11) before the restriction

Figure 2-Figure 7 shown illustration of electrophoresis result before and after restriction with the enzymes Sac II. Electrophoresis results before and after RFLP shown in Figure 2-Figure 7. Presence of mutation indicate by single fragment in electrophoresis after samples digested by enzymes Sac II. In this study we found mutation in GyrA in 6 (R2, R4, R5, R7, R8 and R9) of resistant samples (Figure 7).

RFLP-PCR

This study was done with PCR-RFLP using restriction enzymes Sac II to determine the mutations in the existing samples.

Figure 5. Electrophoresis Results of Sensitive Samples (S1-S11)  after restriction enzyme Sac II
Figure 6. Electrophoresis Results of Sensitive Samples (S12 and S13) after restriction enzyme Sac II. Non Mutant strain indicate by double fragment/band
Figure 7. Electrophoresis results of resistant samples (R1-R11) after restriction enzyme Sac II Samples in Slot R2, R4, R5, R7, R8 and R9 were mutant strains, indicate by single fragment/band

4. Discussion

In the present study, we found mutations in type II topoisomerase genes (GyrA) in 6 (54.5%) of 11 ciprofloxacin resistant strains. There was no mutation found in other 5 resistant strains. Our results demonstrate that mutation in topoisomerase II (GyrA) related to presence of P. aeruginosa resistant strains. Ciprofloxacin is the most active new quinolone antimicrobial agents. It is bactericidal against a broad spectrum of gram-positive and gram-negative microorganisms, including Pseudomonas aeruginosa. Most of P. aeruginosa strains are sensitive to ciprofloxacin at 0.5ug/ml. Previous studies have been reports of decreased susceptibility to ciprofloxacin during therapy in clinical studies of P. aeruginosa infections [2]. Quinolone resistance mechanisms have been reported in a wide variety of organisms [13]. This resistance related to specific mutations that lead to amino acid alterations in the quinolone-resistance determining regions (QRDRs) [13]. This regions constituting topoisomerase II and topoisomerase IV, which are involve in DNA replication, recombination, transcription and in the partitioning of replicated chromosome. Topoisomerases are the important targets for antibacterial and anticancer drugs [13]. Topoisomerase inhibitors convert topoisomerases into topoisomerase-DNA complex or cleavable complex as a topoisomerase-drug-DNA ternary complex. These ternary complex formation is critical for the cytotoxicity [7]. Mutations in topoisomerases genes are the main mechanism of fluoroquinolone resistance in many bacteria [4, 10]. The main mutations for gyrA on codons 83 and 87 found to be related to fluoroquinolone resistance [1, 14].

In this study, 5 (45.4%) of 11 ciprofloxacin resistant samples found to be non mutant P. aeruginosa. This suggests that there is another mechanism of ciprofloxacin resistance in P. aeruginosa. Three mechanisms of resistance are known to cause quinolone resistance in P. aeruginosa: alteration in DNA gyrase by mutations in gyrA or gyrB genes, decreased drug accumulation by decreased permeability of the cell wall, and enhanced efflux [10].

5. Conclusion

Presence of mutations in topoisomerase II (gyrase A) by using PCR-RFLP technique suggest that mutation in topoisomerases genes are the main mechanism of fluoroquinolone resistance in P. aeruginosa.

References

[1]  De la Fuente CM, Dauros SP, Bello TH, Dominguez YM, Mella MS, Sepulveda AM, Zemelman ZR, Gonzalez RG: [Mutations in gyrA and gyrB genes among strains of Gram-negative bacilli isolated from Chilean hospitals and their relation with resistance to fluoroquinolones]. Revista medica de Chile 2007, 135(9): 1103-1110.
In article      CrossRef
 
[2]  Masecar BL, Celesk RA, Robillard NJ: Analysis of acquired ciprofloxacin resistance in a clinical strain of Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy 1990, 34(2): 281-286.
In article      CrossRefPubMed
 
[3]  Takenouchi T, Sakagawa E, Sugawara M: Detection of gyrA mutations among 335 Pseudomonas aeruginosa strains isolated in Japan and their susceptibilities to fluoroquinolones. Antimicrobial agents and chemotherapy 1999, 43(2):406-409.
In article      PubMed
 
[4]  Mouneimne H, Robert J, Jarlier V, Cambau E: Type II topoisomerase mutations in ciprofloxacin-resistant strains of Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy 1999, 43(1): 62-66.
In article      PubMed
 
[5]  Akasaka T, Tanaka M, Yamaguchi A, Sato K: Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrobial agents and chemotherapy 2001, 45(8):2263-2268.
In article      CrossRefPubMed
 
[6]  Dougherty TJ, Nayar A, Newman JV, Hopkins S, Stone GG, Johnstone M, Shapiro AB, Cronin M, Reck F, Ehmann DE: NBTI 5463 is a novel bacterial type II topoisomerase inhibitor with activity against gram-negative bacteria and in vivo efficacy. Antimicrobial agents and chemotherapy 2014, 58(5):2657-2664.
In article      CrossRefPubMed
 
[7]  Hiasa H, Shea ME: DNA gyrase-mediated wrapping of the DNA strand is required for the replication fork arrest by the DNA gyrase-quinolone-DNA ternary complex. The Journal of biological chemistry 2000, 275(44):34780-34786.
In article      CrossRefPubMed
 
[8]  Diver JM, Schollaardt T, Rabin HR, Thorson C, Bryan LE: Persistence mechanisms in Pseudomonas aeruginosa from cystic fibrosis patients undergoing ciprofloxacin therapy. Antimicrobial agents and chemotherapy 1991, 35(8):1538-1546.
In article      CrossRefPubMed
 
[9]  Zhanel GG, Karlowsky JA, Saunders MH, Davidson RJ, Hoban DJ, Hancock RE, McLean I, Nicolle LE: Development of multiple-antibiotic-resistant (Mar) mutants of Pseudomonas aeruginosa after serial exposure to fluoroquinolones. Antimicrobial agents and chemotherapy 1995, 39(2):489-495.
In article      CrossRefPubMed
 
[10]  Cambau E, Perani E, Dib C, Petinon C, Trias J, Jarlier V: Role of mutations in DNA gyrase genes in ciprofloxacin resistance of Pseudomonas aeruginosa susceptible or resistant to imipenem. Antimicrobial agents and chemotherapy 1995, 39(10):2248-2252.
In article      CrossRefPubMed
 
[11]  Hatta M, Smits HL: Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples. The American journal of tropical medicine and hygiene 2007, 76(1):139-143.
In article      PubMed
 
[12]  A. Kureishi, JM Diver, B. Beckthold, T. S, L.E. B: Gen Bank, Pseudomonas aeruginosa gi: 459928, accession L29417, NCBI, nucleotide, PubMed 7811002. In.; 1995.
In article      
 
[13]  Valdezate S, Vindel A, Echeita A, Baquero F, Canto R: Topoisomerase II and IV quinolone resistance-determining regions in Stenotrophomonas maltophilia clinical isolates with different levels of quinolone susceptibility. Antimicrobial agents and chemotherapy 2002, 46(3):665-671.
In article      CrossRefPubMed
 
[14]  Gorgani N, Ahlbrand S, Patterson A, Pourmand N: Detection of point mutations associated with antibiotic resistance in Pseudomonas aeruginosa. International journal of antimicrobial agents 2009, 34(5):414-418.
In article      CrossRefPubMed
 
  • CiteULikeCiteULike
  • MendeleyMendeley
  • StumbleUponStumbleUpon
  • Add to DeliciousDelicious
  • FacebookFacebook
  • TwitterTwitter
  • LinkedInLinkedIn