A bacterial isolate designated SM1 was isolated from Dhapa municipality solid waste dumping ground in Kolkata, India. It was found to be resistant to high levels of Nickel as well as other toxic metals. Upon ribotyping SM1 was found to be Proteus mirabilis with a Genbank accession number of KT873815. The isolate was seen to accumulate nickel in its cell cytoplasm as found out by TEM, EDXRS and XRD analysis. The isolate further produced Siderophore and Indole Acetic acid (IAA) and showed Plant Growth Promotion chracteristics when tested on Indian mustard (Brassica hirta) leading to significant decrease in the nickel amassing by plants when the mustard seeds were grown in nickel contaminated soil along with the isolate.
Utilizing its metabolic activity, living bacteria could amass heavy metals inside the cell. A few investigators 1, 2, 3 detailed about numerous heavy metal accumulating indigenous bacteria. Heavy metals have also been accumulated by Rhizobacteria. A subset of rhizosphere bacteria that colonize the root environment is termed rhizobacteria 4, 5. Root-colonizing bacteria which are beneficial, namely, the PGPR are encompassed by three perspectives: (I) to colonize the root must be their inherent property, (ii) in microhabitats related with the root surface, they must survive and multiply, in contest with other microbiota, until the time expected for their plant promotion/protection functions to be expressed, and (iii) plant growth should be promoted by them. The region surrounding the plant root system is called a rhizosphere, described by efficiency of improved biomass. Root nutrients discharged from roots, like organic acids, enzymes, amino acids, and complex sugars are accepted by rhizosphere microbes 6, 7, 8. Consequently, the plant growth promoting rhizobacteria benefit the plant in different ways. Plant growth is upgraded by PGPR by environmental nitrogen fixation, phytohormone production, explicit enzymatic action and plant protection from illnesses by delivering anti-microbial and other pathogen-depressing substances, for example, siderophores and chelating agents 9. Apart from that, bacterial populace is given a steady state redox condition and an underlying surface for by the root tips. Air is circulated through the soil by the plant root framework, bacteria is distributed through soil, and any case impermeable soil layers is infiltrated by roots while soluble forms of the contaminants of the soil water are attracted towards the plant and the microorganisms. Phytoremediation innovations with the use of PGPR is presently being considered to assume a significant part as plant development is helped by adding PGPR on polluted locales 10 and amplify detoxification of soil 11. Kuiper et al., 12 has analysed that for efficient rhizoremediation purpose, useful plant-microbe interaction is essential. Burd et al. 13 saw that Indian mustard seeds in quantity, sprouting in a soil polluted by nickel, and the plant size achievable expanded by 50%~100% by the inoculation of Klebsiella ascorbata SUD165/26, an associated plant growth promoting rhizobacteria, in initial field trials to the soil; and de Souza et al. 14, 15 examined that in constructed wetlands, phytoremediation of Se and Hg and that accumulation of Se and Hg were improved by rhziobacteria in wetland plant. Abou-Shanab et al. 16 detailed that the addition of Sphingomonas macrogoltabidus, Microbacterium liquefaciens, and M. arabinogalactanolyticum to Alyssum murale grown in serpentine soil causes amplified the plant take-up of Ni when contrasted with the uninoculated controls because of soil pH decrease. Burd et al. 10, 13, detailed that in presence of heavy metals including nickel lead and zinc, some plant growth promoting bacteria can essentially increase the growth of plants, and accordingly permitting plants to foster longer roots and get better established during beginning phases of development 17. Solubility, is the main cause of the bioavailability of heavy metals in soils 18 with the main controlling variables being pH and organic matter content 19. A strain of Ps. maltophilia was displayed to diminish the portable and poisonous Cr6+ to nontoxic and immobile Cr3+, and furthermore limit the mobility of other harmful ions like Hg2+, Pb2+ and Cd2+ 20, 21.
A global concern is the Ecological pollution with toxic metals. The most generally perceived toxins of climate are known to be Copper, chromium, cadmium and nickel, etc 22. Consistently one of the sources of such pollution are landfills 23. Kolkata's Dhapa soild waste dumping ground is such a landfill. "Garbage farming" is enabled in this landfill site. The territories of Dhapa solid waste dumping grounds produce over 40% of the green vegetables in the Kolkata markets. Four regions in Dhapa for dumping garbage are there, that are stacked up with 2,500 tons of waste every day. Ecological contamination and pollution caused by heavy metals in the soil and waste water effluents in the Dhapa region are due to rapid urbanization and industrialization. Preliminary exploration works 24 have been done in the setting to a find, in Dhapa soil, a predominance of metal resistant and antibiotic resistant microorganisms. Scientists 25 also showed that in the waste waters of Dhapa dumping ground, there is a presence of copper bioremediating microorganisms. Different lines of exploratory discoveries 26, 27 showed that presence of nickel resistant microbes has been investigated on Dhapa Solid waste dumping grounds. The present study revolves around such a nickel resistant bacteria that shows PGPR activities. Our take to further progress the limited work done on Dhapa dumping ground.
The isolate initially designated SM1, was cultured in Nutrient Agar (NA)[ Nutrient agar (NA) : Peptone 5 gm, NaCl 5 gm, Yeast extract 1.5 gm, Agar 15 gm, H2O 1000 ml, pH 7.2±0.2] ,Nutrient Broth (NB) and a minimal media Tris minimal media with Glucose (TMMG) [[[(gm/lit.) Tris base: 6.05; (NH4)2SO4 0.96; KCl: 0.62; glycerol -2- phosphate: 0.67; MgSO4: 0.063; FeSO4: 0.003; Glucose 0.8%; Agar 15. pH adjusted to 7.2 by 2M HCl] both agar and broth and the MTC was recorded at different concentration of various metals. The assay was done in 5 sets.
2.2. Ribotyping of Isolate and 16 S rDNA CharacterizationThe high fidelity PCR Master Kit (Roche Applied Science, Germany) was used for PCR amplification reactions taking 50 ng of template genomic DNA and 1 µM of every one of the primer pair. The primer sets were utilized for 16S rRNA gene amplification were bacterial explicit primer sets f27(5'-AGAGTTTGATCCTGGCTCAG-3'), r1492 (5'- TACGGTTACCTTGTTACGACTT - 3') 28. Subsequent phylogenetic tree formation was done by bioinformatics tools.
2.3. Scanning Electron Micrograph of IsolateA protocol of SEM, as per Miller et al 29 with certain alterations, for bacteria was performed. Cells cultured overnight in TYE broth (Tryptone 1%, Yeast concentrate 0.5. %, NaCl 0.8%, pH 7.2) (both with and without Nickel). 1ml of 6% Glutaraldehyde to 1 ml of culture was added to fix the cells. The fixed culture was incubated at room temperature for 5 hours, 0.1M Sodium cacodylate (pH 7.2) was mixed with the suspension and to a syringe mounted membrane filter (pore size 0.1 µm) a part was applied, immersed with sodium cacodylate buffer. While they were in syringe mounted holder, membrane bound cells were washed with 3 volumes of 0.1 M sodium cacodylate., cells were gradiently dehydrated in alcohol after the membranes were removed from the filtering apparatus, critical point dried in a model Samdri-PVT-3B apparatus and afterward coated with 20 nm of Gold-palladium in a model Hummer V sputter coater. Micrographs were acquired at 05 kV with a model 505T Scanning electron microscope (Leica).
2.4. Transmission Electron Microscopy of IsolateIn TMMG broth, bacterial cells were grown for 70 subcultures both in Nickel free and Nickel supplemented medium. Bacterial cells (Over night culture) from Nickel treated (2 mM) and untreated medium were precipitated by centrifugation (8000 g for 10 min at 4°C) and phosphate buffer saline (pH 7.2) was used to wash a few times. Equivalent volume of 3% glutaraldehyde in buffer was used to fix the concentrated cells, for 1 h,1% osmium tetroxide for 1 h was used to post fix. Ethanol [30, 50, 70, 90 and 100 percent (v/v); 30 min at each step] was used to progressively dehydrate the cells, lastly embedded in SPURRT resin. With a Dupont diamond knife in a LKB Ultramicrotome, thin sectioned were cut, and were loaded in formvar carbon-covered lattice and observed in JEOL 100 CX transmission electron microscope at various magnifications.
2.5. Energy Dispersive X-ray Spectroscopy (EDXRS) Analysis Of IsolateEnergy dispersive X-ray analysis of the sample was done with EX-64165 JMU, JEOL (Japan).Plotting was done in Origin software.
2.6. X-ray Powder Diffraction (XRD) Analysis of Isolate1 L of TMMG broth containing either 2 mM of Ni as NiCl2 or no Ni were used to culture the bacterial cells. After 48 h, the cells were centrifuged by centrifugation (8000 g for 10 min at 4°C) and sterile water wash was done a few times. To get dry cell mass, the collected cells were then freeze dried. in a Seifert 3000P Powder Diffractometer utilizing monochromatic Cu Kα1 radiation (λ = 1.540598 Å), the X-beam diffraction pattern of the Ni treated or untreated lyophilized cells of the bacterial strain were recorded. Ranging between 10º to 90º (2θ), the diffraction spectra were recorded with a stage length of 0.02º (2θ), the trial X-beam diffraction pattern was contrasted, to distinguish the nickel salt and with help from Joint Committee on Powder Diffraction Standards document (1978). Plotting was done in Origin software.
2.7. Detection of Siderophore Production by the IsolateOn chrome azurol sulfone (CAS) blue plates, fresh bacterial isolate inoculum was cultured, following the convention of Schwyn and Neilands 30. 1 L CAS agar was made by, in 50 ml water dissolve 60.5 mg CAS and blended in with 10 ml iron solution (1 mM FeCl3 in 10 mM HCl). This solution was gradually blended in 72.9 mg hexadecyltrimethyl ammonium bromide (HDTMA) dissolved in 40 ml water. The resultant deep blue fluid was autoclaved. 100 ml of the CAS solution was mixed in with 900 ml of sterile mannitol complete medium [K2HPO4, 0.5; MgSO4. 7H2O, 0.4; NaCl, 0.1; NH4NO3, 1.0; mannitol, 10.0; agar 15 (g/L).] supplemented with 30.24 g piperazine-N,N'- bis(2-ethane sulphonic acid (Pipes) and adjusting pH to 6.8 with 1N NaOH, mixed in with Casamino Acid Solution{ Dissolve 3 g of Casamino acid in 27 ml of ddH2O; Extract with 3% 8-hydroxyquinoline in chloroform to eliminate any trace iron; Filter sterilize}. To make CAS agar plates, the blended solution in hot was poured on the plates. The ferric iron from the CAS-iron complex is snatched by the siderophore produced by the organism making a colour change from blue to yellowish-orange around the colony. Such change is demonstrative of siderophore production positive. The requisite broth preparation lacks addition of agar to the same process of preparation.
2.8. Detection of Indole Acetic Acid (IAA) Production by IsolateThe procedure of Gordon and Weber 31 was followed for IAA quantification. Overnight incubation at 37°C on NB with or without tryptophan (500 μg/ml, filter sterilized) with the bacterial culture was done and subsequently the bacterial cells were precipitated from the culture medium by centrifugation. 4 ml of Salkowski's reagent (150 ml conc. H2SO4, 250 ml H2O, 7.5 ml 0.5 M FeCl3. 6H2O) was blended vigorously with one ml of the supernatant, permitted to stand 20 minutes and the absorbance was estimated at 535 nm with spectrophotometer. Standard curve was performed by IAA (Sigma) concentration against O.D.
2.9. Plant Growth Promotion Assay with the IsolateWith a stable tetracycline resistant mutant (100 µg/ml) of the bacterial strain SM1, the In situ growth promotion of plants and rhizosphere colonization study was performed. Surface sterilized (with 0.1% HgCl2 for 2 minutes, then, at that point, washed over and over with sterile water) mustard seeds were imbibed either with sanitized water or with bacterial suspension for one hour in clean sterilized container and afterward planted in solarized clay pots containing sterile soil (fresh soil, air dried, autoclaved for 1 hour for 3 consecutive days) and kept in the growth chamber (BOD incubator) to keep away from microbial contamination. Clay pots utilized for the trial had top diameter across of 22.5 cm, base width of 16.0 cm and a height of 16.8 cm. To assess the impacts of Ni harmfulness, seedlings were irrigated every 3 days either with disinfected water (control) or with 200 ml of 200 µM Ni as sterile NiCl2 solution. The decision of such low Ni concentration was for avoiding from extreme impact on test plants because of amassing of Ni in the soil because of sequential irrigation with Ni salt. The plants were plucked after 25 days and estimation of growth parameters was done before dry weight assessment.
2.10. Estimation of Iron Content of Leaves after Pot ExperimentsThe procedure for Rangarajan and Kelly 32 with little alteration was followed for the total iron content in the leaves estimation. In a crucible, one gram of fresh leaves was taken and dried at 105°C. acid digestion of the dried sample was done in a combination of conc. HNO3 and HClO4 (4:1, v/v). The iron content in the digest was estimated by atomic absorption spectrometer (AAS).
2.11. Estimation of Leaf Chlorophyll Content of Plant after Pot ExperimentThe process for Arnon 33 was followed for the chlorophyll content estimation from leaf slices weighing one gram by extraction from leaf tissue in 85% Acetone. Absorbance of the extract was acquired at 665 nm and 649 nm separately. Total chlorophyll content (mg/g fresh weight) = [(13×95 × A665 - 6×88 × A649) + (24×96 × A649 - 7×32 × A665) ×V]/ (1000 × W), with V being the volume of the extract and W being the fresh weight (g) of leaf tissue.
2.12. Root Colonizing Ability Assay of the IsolateSoil samples, adhering to the roots of the previously mentioned plants utilized for growth promotion assay, eliminated from the roots and bacterial populace (cfu/g of soil) was measured by dilution plating on NA plates with tetracyclin (100 µg/ml) or without tetracyclin for the evaluation of contaminants, if any, to study rhizosphere colonization. Maceration of washed roots in sterile PBS and the subsequent suspension was plated as referenced previously, to study Rhizoplane population.
2.13. Estimation of Nickel in Plants after Pot ExperimentsMicroorganisms were disposed of before the evaluation of Ni in the root samples by continued washing with 0.01 M EDTA and sterile water to avoid impediment of Ni amassed by rhizoplane microbes. The washed root samples or shoot samples were then dried at 105°C and were handled in a blend of conc. HNO3 and HClO4 (4:1, v/v) 34. The Ni content in the digest was estimated by atomic absorption spectrometer (AAS).
The isolate as initially designated SM1, showed up to 10.4 mM tolerance to Nickel in NA and 6.5 mM in TMMG agar. The tolerance of SM1 was up to 8.7 mM to Nickel in NB and 3.9 mM in TMMG broth. Other metals’ tolerance was also shown as represented in the following Table 1 and Table 2 showing the respective Maximal Tolerable Concentrations (MTC).
Based on analysis the isolate SM1 was found to be Proteus mirabilis. The Genbank accession number is KT873815.
Scanning electron micrograph (Figure 3A and B) of SM1 uncovered that the bacterial size was small with reticulated cell surface without Nickel in medium. Anyway in presence of Nickel in medium, the bacterial cell surface almost smooth and wooly and the bacterial cell enlarged in size (adsorption of nickel on cell surface or emission of exopolysaccharides by cells might be the plausible explanations). Cell dimensions in absence on Nickel was: surmised cell length: 1377.1 nm, rough cell width: 575 nm
3.4. Transmission Electron Microscopy of IsolateThe Transmission electron microscopy of isolate is as follows,
Electron dense dark granules distributed in the cytosol and towards the cell envelope was seen in TEM analysis of 20 hrs grown culture without (Figure 4A) or with (Figure 4B) 2 mM of Ni suggesting possible Ni accumulation.
3.5. Energy Dispersive X-ray Spectroscopy (EDXRS) Analysis of IsolateThe Energy dispersive X-ray spectroscopy (EDXRS) analysis of isolate is represented graphically as follows,
Peaks only for carbon, oxygen and phosphorous were seen in Control cells, while in the Ni loaded cell sample specific peaks (1.12 and 7.56 keV) for Ni showed in addition, showed that Ni accumulated in the cytosol of bacterial cell (Figure 5A and B).
3.6. X-ray Powder Diffraction (XRD) Analysis of IsolateThe X-ray powder diffraction (XRD) analysis of isolate is represented graphically as follows,
In the wake of growing the cells in absence (Figure 6A) or presence of 2 mM (Figure 6B) Ni for 48 h, the chemical nature of cellular Ni (II) was found out utilizing X-beam diffraction investigation of powdered bacterial biomass. Demonstrating the amorphous nature of the sample the diffractogram of control metal free cells lacks a distinct peak. Two particular peaks of the X-beam spectra were observed with the cells supplemented with 2 mM Nickel, demonstrating the deposition of crystalized metal. In light of D values, peaks at 2θ = 31.2° and 36.59° can be appointed to the accumulation of nickel phosphides (NiP2 and Ni5P4), firmly recommending formation of insoluble metal crystals by the interaction of Ni(II) with phosphoryl groups of cell constituents.
3.7. Detection of Siderophore Production by the IsolateYellow coloured colony on blue CAS agar plate (Figure 7) showed positive siderophore production by the isolate. Production of Siderophore (Figure 8A) was observed to be maximum of 18.59 µM at 4.5 mM of Ni concentration as revealed by quantitative studies by CAS assay. Nonetheless, the increase of Ni concentration in the medium inhibited the bacterial growth and evidently affected siderophore production. Above or beneath the ideal Ni concentration, Siderophore production was found to fall. Results (Figure 8B) demonstrate that a maximum of 6.21 µM Siderophore production was seen at 30°C as quantified by CAS assay. In any case, at lower temperatures, low bacterial growth was seen in the medium which obviously affected siderophore production. Above or underneath the ideal temperature, Siderophore creation was found to fall. Results (Figure 8C) demonstrate that a maximum of 6.98 µM Siderophore production was seen at 10 mM NaCl as evaluated by CAS assay. Be that as it may, at higher saline concentrations, the low bacterial growth was seen in the medium which obviously affected siderophore production. Above or underneath the ideal saline concentration, Siderophore production was found to fall.
3.8. Detection of Indole Acetic Acid (IAA) Production by IsolatePositive Indole Acetic Acid (IAA) production by the isolate (Figure 9) was seen by the red colouration. The different temperatures, different pH, different NaCl concentrations and different Nickel concentrations dependence on Assay of IAA production is shown by the following graphs (Figure 10). The greatest quantities of IAA was produced at 35°C both without tryptophan supplemented medium conditions (1.47 ± 0.97 µg/ml) as well as in tryptophan supplemented medium (21.43 ± 3.58 µg/ml) by the isolate. At lower temperatures for both trp-and trp+ medium, than at higher temperatures (Figure 10A), production of IAA was less. Maximum quantities of IAA produced was at pH= 7 both without tryptophan supplemented medium circumstances (1.47 ± 0.97 µg/ml) as well as in tryptophan supplemented medium (21.43 ± 3.58 µg/ml) by the isolate. For both for trp-and trp+ medium, other than at ideal pH (Figure 10B), production of IAA drops. The greatest amount of IAA was produced at 10 mM NaCl concentration both without tryptophan supplemented medium circumstances (1.65 ± 0.95 µg/ml) as well as in tryptophan supplemented medium (22.84 ± 2.88 µg/ml) by the isolate. For both for trp-and trp+ medium, as the NaCl concentration increases (Figure 10C), production of IAA drops. The greatest measures of IAA was produced at 2 mM Nickel concentrations both without tryptophan supplemented medium circumstances (1.62 ± 0.46 µg/ml) as well as in tryptophan supplemented medium (24.14 ± 1.67 µg/ml) by the isolate. For both for trp-and trp+ medium, as the Nickel concentration increases (Figure 10D), production of IAA drops.
3.9. Plant Growth Promotion Assay with the IsolateThe Model plant chosen for the assay was Indian mustard (Brassica hirta). The culture conditions were monitored were four [d: Nickel fed plant seed with inoculum ( A+Ni+SM1); c: Nickel fed plant seed without inoculum ( A+ Ni); b : No nickel fed plant seed with inoculum (A+SM1); a : No nickel fed plant seed without inoculum (Control : A)]. (Figure 11 and Table 3). Mustard shoot length was greatest in no nickel fed inoculated seeds (23.05 cm) an increment of 86.94% from control conditions (12.33 cm) as seen by the Observations. A likewise increase of in no nickel inoculated seeds (15.22 cm) was by 149.09% from control (6.11 cm) as seen in Mustard root length. At no nickel inoculated seeds, Wet and dry weights of plants were additionally maximum. More growth and weight was seen in nickel fed inoculated seeds of the plants than in control and nickel fed non inoculated seeds. The results showed plant growth was promoted by the isolate when inoculated in soil alongside plant seeds (Figure 11 and Table 3).
The positive impact of SM1 in iron mobilization from soil was showed in Iron assessment in the leaves (Figure 12) of the test plants. An increased iron content in the leaves of both the plants (335.46 ± 1.70 for no nickel inoculated plants and 272.73 ± 2.37 for nickel fed inoculated plants) tried over the control plants was seen as seeds were inoculated by SM1 in mustard plant. As contrary impact was seen in the plant growth including the iron status for the leaves of both the plant tried by the irrigation with Ni salt. Nonetheless, iron procurement by the plants was helped when SM1 was applied in the seeds of the plant. As a result, iron content in the leaves was renewed fundamentally re-establishing its wellbeing from being chlorotic.
3.11. Estimation of Leaf Chlorophyll Content of Plant after Pot ExperimentThe strain potentially protects plant from chlorophyll loss as evidenced increase in chlorophyll content in the mustard leaves by 18.65% from control (A) to A+SM1 (a) (Figure 13) from the experiment.
The isolate could survive and amplify in the root environment of the plant tested (Table 4) as seen by the Dilution plating of tetracycline marked SM1 from the rhizosphere and rhizoplane of mustard plants on NA plates supplemented with (100 µg/ml) tetracycline. Mustard rhizosphere soil was colonized by the strain (9x105 cfu/g of fresh soil). Mustard rhizoplane bacterial populace was (8x106 cfu/g fresh weight of root). No bacterial colony was seen for Dilution plating of rhizosphere soil sample and rhizoplane suspension from uninoculated plant in NA plates. Once more, it was seen that there was little variety in the populace size got from dilution plating of rhizosphere soil sample and rhizoplane suspension from inoculated plant, in NA plates with or without tetracycline. Dilution plating of rhizosphere soil samples and rhizoplane suspensions from inoculated plants of various treatment systems showed that other than SM1 very little bacteria were identified on NA plates.
3.13. Estimation of Nickel in Plants after Pot ExperimentsDiminished Ni load essentially on the different plant for both the plants was seen as SM1 colonized the rhizospheric climate. The strain was additionally found to diminish 58.27% and 59.50% of Ni take-up in both roots and shoots separately (Figure 14) as showed by the outcomes which were significant in the case of mustard plants.
Upon detailed analysis the isolate SM1 also found to be Proteus mirabilis KT873815 was seen to be resistant to up to 10.4 mM nickel in Nutrient Agar and 6.5 mM nickel in TMMG agar (Table 1). Similar results were seen in Nutrient broth and TMMG broth also where the isolate was seen to be resistant to up to 8.7 mM and 3.9 mM respectively (Table 2). The bacterial was seen to be rod shaped with dual appearance when grown in presence and absence of nickel (Figure 3A and 3B). Upon examining the isolate by Transmission Electron Microscopy (TEM) the bacterial cells showed black deposition in its cytosol (Figure 4A and 4B) which was analysed to be precipitated Nickel crystals of phosphide (Figure 5A and B; Figure 6A and B). The isolate showed PGP (Plant Growth Promoting) characteristics in terms of its ability to produce Siderophore (Figure 7; Figure 8A, B and C) and Indole Acetic Acid (IAA) (Figure 9; Figure 10A, B, C and D). Upon performing pot experiments with Indian mustard seeds the isolate showed its ability to support plant growth in no nickel fed soil and also its ability to boost plant growth in contrast to nickel fed uninoculated seeds samples (Figure 11 and Table 3). Isolate also showed enhanced iron uptake (Figure 12) as well as enhanced chlorophyll content (Figure 13) by plants when the isolate was used in conjunction with the plant seeds. The isolate shown significant root colonizing ability (Table 4) of plant rhizosphere and rhizoplane. Also when used in conjunction to plant seeds, the isolate reduced the nickel load in various plant parts (Figure 14). Hence the isolate could be termed a Plant Growth Promoting Rhizobacteria (PGPR) which happens to be accumulating Nickel within its cell.
Plant Growth Promoting Rhizobacteria (PGPR) have been known to accumulate toxic metals within itself 10. Following their footsteps, we have isolated such a candidate from Dhapa municipal waste dumping ground soil. Future endeavours may include further study into more such sites to isolate more such PGPR that are resistant to toxic metals. Scanning for more such PGP activities pertaining to bacteria would definitely be a boon to humankind.
The author would like to thank guide Dr. Pranab Kumar Banerjee (Associate Professor, Dept. of Zoology, Serampore College) for helpful suggestions and guidance. The author would also like to thank Honourable Principal of Ramakrishna Mission Vidyamandira for his kind assistance and help during pursuing the research work in the premises.
| [1] | Higham D.P., Sadler P.J., Scawen M.D., Cadmium-binding proteins in Pseudomonas putida: pseudothioneins. Environ Health Perspect 65: 5-11. 1986. | ||
| In article | View Article PubMed | ||
| [2] | Wang C.L., Michels P.C., Dawson S.C., kitisakkul S., Baross J.A., Keasling J.D., Clark D.S., Cadmium removal by a new strain of Pseudomonas aeruginosa in aerobic cultutre. Appl Environ Microbiol 63: 4075-4078. 1997. | ||
| In article | View Article PubMed | ||
| [3] | Sar P, Kazy S.K., Singh S.P., Intracellular nickel accumulation by Pseudomonas aeruginosa and its chemical nature. Lett Appl Microbiol 32: 257-261. 2001. | ||
| In article | View Article PubMed | ||
| [4] | Kloepper J.W., Plant growth-promoting rhizobacteria (other systems). In: Okon Y.Y .(ed) Azospirillum/plant associations. Boca Raton, FL, USA: CRC Press, 1994, PP 111-118. | ||
| In article | |||
| [5] | Kloepper JW, Zablotowick RM, Tipping EM, Lifshitz R, Plant growth promotion mediated by bacterial rhizosphere colonizers. In: Keister D.L., Cregan P.B. (eds) The rhizosphere and plant growth. Dordrecht, The Netherlands: Kluwer Academic Publishers, 1991, pp 315-326. | ||
| In article | View Article | ||
| [6] | Anderson T.A., Guthrie E.A., Walton B.T., Bioremediation in the rhizosphere. Environ Sci Technol 27: 2630-2636. 1993. | ||
| In article | View Article | ||
| [7] | Yee D.C., Maynard J.A., Wood T.K., Rhizoremediation of trichloroethylene by a recombinant, root-colonizing Pseudomonas fluorescens strain expressing toluene ortho-monooxygenase constitutively. Appl Environ Microbiol 64: 112-118. 1998. | ||
| In article | View Article PubMed | ||
| [8] | Shim H., Chauhan S., Ryoo D., Bowers K., Thomas S.M., Canada K.A., Burken J.G., Wood T.K., Rhizosphere competitiveness of trichloroethylene-degrading poplar-colonizing recombinant bacteria. Appl Environ Microbiol 66: 4673-4678. 2000. | ||
| In article | View Article PubMed | ||
| [9] | Kamnev A.A., van der Lelie, Chemical and biological parameters as tools to evaluate and improve heavy metal phytoremediation. Biosci Rep 20: 239-58. 2000 | ||
| In article | View Article PubMed | ||
| [10] | Burd G.I., Dixon G.D., Glick B.R., Plant growth promoting bacteria that decrease heavy metal toxicity in plants. Can J Microbiol 46: 237-245. 2000. | ||
| In article | View Article PubMed | ||
| [11] | Mayak S., Tirosh T., Glick B.R., Plant growth-promoting bacteria that confer resistance to water stress in tomatoes and peppers. Plant Sci 166: 525-530. 2004. | ||
| In article | View Article | ||
| [12] | Kuiper I., Lagendijk E.L., Bloemberg G.V., Lugtenberg B.J.J., Rhizoremediation: a beneficial plant-microbe interaction. Mol Plant-Microbe Interact 17: 6-15. 2004. | ||
| In article | View Article PubMed | ||
| [13] | Burd G.I., Dixon D.G., Glick B.R., A plant growth-promoting bacterium that decreases nickel toxicity in plant seedlings. Appl Environ Microbiol 64: 3663-3668. 1998. | ||
| In article | View Article PubMed | ||
| [14] | de Souza M.P., Chu D., Zhao M., Zayed A.M., Ruzin S.E., Schichnes D., Terry N., Rhizosphere bacteria enhance selenium accumulation and volatilization by Indian mustard. Plant Physiol 119: 565-573. 1999a. | ||
| In article | View Article PubMed | ||
| [15] | de Souza M.P., Huang C.P., Chee N., Terry N., Rhizosphere bacteria enhance the accumulation of selenium and mercury in wetland plants. Planta 209: 259-263. 1999b. | ||
| In article | View Article PubMed | ||
| [16] | Abou-Shanab R.A., Angle J.S., Delorme T.A., Chaney R.L., van Berkum P., Moawad H., Ghanem K., Ghozlan H.A., Rhizobacterial effects on nickel extraction from soil and uptake by Alyssum murale. N Phytol 158: 219-224. 2003. | ||
| In article | View Article | ||
| [17] | Glick B.R., Penrose D.M., Li J.P., A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. J Theor Biol. 190(1):63-68. 1998. | ||
| In article | View Article PubMed | ||
| [18] | Ernst W.H.O., Bioavailability of heavy metals and decontamination of soils by plants. Appl Geochem 11: 163-167. 1996. | ||
| In article | View Article | ||
| [19] | Gray C.W., McLaren R.G., Roberts A.H.C., Condron L.M., Sorption and desorption of cadmium from some New Zealand soils: effect of pH and contact time. Aust J Soil Res 36: 199-216. 1998 | ||
| In article | View Article | ||
| [20] | Blake R.C., Choate D.M., Bardhan S., Revis N., Barton L.L., Zocco T.G., Chemical transformation of toxic metals by a Pseudomonas strain from a toxic waste site. Environ Toxicol Chem 12: 1365-1376. 1993. | ||
| In article | View Article | ||
| [21] | Park C.H., Keyhan M., Matin A., Purification and characterization of chromate reductase in Pseudomonas putida. Abs Gen Meet. American Soc Microbial 99: 536-548. 1999. | ||
| In article | |||
| [22] | Abbas B.F., Khamis W.M., Abdullah A.M., Sha H., Environmental Pollution with the Heavy Metal Compound. Res. Journ. of Pharm. And Tech. 11(9)(0974-3618): 4035-4041. 2018. | ||
| In article | View Article | ||
| [23] | Othman R., Latiff H.N.M., Baharuddin Z.M., Closed Landfill Heavy Metal Contamination Distribution Profiles At Different Soil Depths And Radiuses. App Econ Environ Res. 17(4): 8059-8067. 2019. | ||
| In article | View Article | ||
| [24] | Samanta A., Bera P., Khatun M., Sinha C., Pal P., Lalee A. and Mandal A., An investigation on heavy metal tolerance and antibiotic resistance properties of bacterial strain Bacillus sp. isolated from municipal waste. J. Microbiol. Biotech. Res., 2 (1): 178-189. 2012. | ||
| In article | |||
| [25] | Ghosh A., Saha P.D., Bioremediation of Copper present in waste water using isolated Micro-organism Stenotrophomonas sp. PD2 from Soil of Dhapa, Kolkata, India. Elix. Poll. 47: 8921-8923. 2012. | ||
| In article | |||
| [26] | Saha A.,Santra S.C., Isolation and characterization of bacteria isolated from municipal solid waste for production of industrial enzymes and waste degradation. J of Microbiol. And Exp. 2014; 1(1): 12‒19. 2014. | ||
| In article | View Article | ||
| [27] | WEST BENGAL POLLUTION CONTROL BOARD. DHAPA DUMPSITE ENVIRONMENTAL AND SOCIAL ASSESSMENT REPORT. FEBRUARY. 2014. | ||
| In article | |||
| [28] | Giovannoni S.J., The polymerase chain reaction. In: Stackebrandt E., Goodfellow M. (eds) Nucleic acid techniques in bacterial systematics. Chichester,UK: Wiley, 1991, pp 177-203. | ||
| In article | |||
| [29] | Miller E.S., Woese C.R. and Brenner S., Description of the erythromycin producing bacterium Arthrobacter sp. NRRL Strain B-3381 as Aeromicrobium erythreum gen. nov.,sp. Nov. int. J of Syst Bacteriol. 41(3): 361-368. 1991. | ||
| In article | View Article PubMed | ||
| [30] | Schwyn B., Neiland JB., Universal chemical assay for the detection of siderophores. Anal Biochem 160: 47-56. 1987. | ||
| In article | View Article | ||
| [31] | Gordon S.A., Weber R.P., Colorimetric estimation of indoleacetic acid. Plant Physiol 26: 192-195. 1951. | ||
| In article | View Article PubMed | ||
| [32] | Rangarajan A., Kelly J.F., Iron bioavailability from Amaranthus Species: In Vitro dialysable iron for estimation of genetic variation. J Sci Food Agric 78: 267-273. 1998. | ||
| In article | View Article | ||
| [33] | Arnon D.I., Copper enzymes in isolated chloroplast. polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1-15. 1949. | ||
| In article | View Article PubMed | ||
| [34] | Chen Y.H., Shen Z.G., Li X.D., The use of vetiver grass (Vetiveria zizanioides) in the phytoremediation of soils contaminated with heavy metals. Appl Geochem 19: 1553-1565. 2004. | ||
| In article | View Article | ||
Published with license by Science and Education Publishing, Copyright © 2022 Santanu Maitra and Pranab Kumar Banerjee
This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/
| [1] | Higham D.P., Sadler P.J., Scawen M.D., Cadmium-binding proteins in Pseudomonas putida: pseudothioneins. Environ Health Perspect 65: 5-11. 1986. | ||
| In article | View Article PubMed | ||
| [2] | Wang C.L., Michels P.C., Dawson S.C., kitisakkul S., Baross J.A., Keasling J.D., Clark D.S., Cadmium removal by a new strain of Pseudomonas aeruginosa in aerobic cultutre. Appl Environ Microbiol 63: 4075-4078. 1997. | ||
| In article | View Article PubMed | ||
| [3] | Sar P, Kazy S.K., Singh S.P., Intracellular nickel accumulation by Pseudomonas aeruginosa and its chemical nature. Lett Appl Microbiol 32: 257-261. 2001. | ||
| In article | View Article PubMed | ||
| [4] | Kloepper J.W., Plant growth-promoting rhizobacteria (other systems). In: Okon Y.Y .(ed) Azospirillum/plant associations. Boca Raton, FL, USA: CRC Press, 1994, PP 111-118. | ||
| In article | |||
| [5] | Kloepper JW, Zablotowick RM, Tipping EM, Lifshitz R, Plant growth promotion mediated by bacterial rhizosphere colonizers. In: Keister D.L., Cregan P.B. (eds) The rhizosphere and plant growth. Dordrecht, The Netherlands: Kluwer Academic Publishers, 1991, pp 315-326. | ||
| In article | View Article | ||
| [6] | Anderson T.A., Guthrie E.A., Walton B.T., Bioremediation in the rhizosphere. Environ Sci Technol 27: 2630-2636. 1993. | ||
| In article | View Article | ||
| [7] | Yee D.C., Maynard J.A., Wood T.K., Rhizoremediation of trichloroethylene by a recombinant, root-colonizing Pseudomonas fluorescens strain expressing toluene ortho-monooxygenase constitutively. Appl Environ Microbiol 64: 112-118. 1998. | ||
| In article | View Article PubMed | ||
| [8] | Shim H., Chauhan S., Ryoo D., Bowers K., Thomas S.M., Canada K.A., Burken J.G., Wood T.K., Rhizosphere competitiveness of trichloroethylene-degrading poplar-colonizing recombinant bacteria. Appl Environ Microbiol 66: 4673-4678. 2000. | ||
| In article | View Article PubMed | ||
| [9] | Kamnev A.A., van der Lelie, Chemical and biological parameters as tools to evaluate and improve heavy metal phytoremediation. Biosci Rep 20: 239-58. 2000 | ||
| In article | View Article PubMed | ||
| [10] | Burd G.I., Dixon G.D., Glick B.R., Plant growth promoting bacteria that decrease heavy metal toxicity in plants. Can J Microbiol 46: 237-245. 2000. | ||
| In article | View Article PubMed | ||
| [11] | Mayak S., Tirosh T., Glick B.R., Plant growth-promoting bacteria that confer resistance to water stress in tomatoes and peppers. Plant Sci 166: 525-530. 2004. | ||
| In article | View Article | ||
| [12] | Kuiper I., Lagendijk E.L., Bloemberg G.V., Lugtenberg B.J.J., Rhizoremediation: a beneficial plant-microbe interaction. Mol Plant-Microbe Interact 17: 6-15. 2004. | ||
| In article | View Article PubMed | ||
| [13] | Burd G.I., Dixon D.G., Glick B.R., A plant growth-promoting bacterium that decreases nickel toxicity in plant seedlings. Appl Environ Microbiol 64: 3663-3668. 1998. | ||
| In article | View Article PubMed | ||
| [14] | de Souza M.P., Chu D., Zhao M., Zayed A.M., Ruzin S.E., Schichnes D., Terry N., Rhizosphere bacteria enhance selenium accumulation and volatilization by Indian mustard. Plant Physiol 119: 565-573. 1999a. | ||
| In article | View Article PubMed | ||
| [15] | de Souza M.P., Huang C.P., Chee N., Terry N., Rhizosphere bacteria enhance the accumulation of selenium and mercury in wetland plants. Planta 209: 259-263. 1999b. | ||
| In article | View Article PubMed | ||
| [16] | Abou-Shanab R.A., Angle J.S., Delorme T.A., Chaney R.L., van Berkum P., Moawad H., Ghanem K., Ghozlan H.A., Rhizobacterial effects on nickel extraction from soil and uptake by Alyssum murale. N Phytol 158: 219-224. 2003. | ||
| In article | View Article | ||
| [17] | Glick B.R., Penrose D.M., Li J.P., A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. J Theor Biol. 190(1):63-68. 1998. | ||
| In article | View Article PubMed | ||
| [18] | Ernst W.H.O., Bioavailability of heavy metals and decontamination of soils by plants. Appl Geochem 11: 163-167. 1996. | ||
| In article | View Article | ||
| [19] | Gray C.W., McLaren R.G., Roberts A.H.C., Condron L.M., Sorption and desorption of cadmium from some New Zealand soils: effect of pH and contact time. Aust J Soil Res 36: 199-216. 1998 | ||
| In article | View Article | ||
| [20] | Blake R.C., Choate D.M., Bardhan S., Revis N., Barton L.L., Zocco T.G., Chemical transformation of toxic metals by a Pseudomonas strain from a toxic waste site. Environ Toxicol Chem 12: 1365-1376. 1993. | ||
| In article | View Article | ||
| [21] | Park C.H., Keyhan M., Matin A., Purification and characterization of chromate reductase in Pseudomonas putida. Abs Gen Meet. American Soc Microbial 99: 536-548. 1999. | ||
| In article | |||
| [22] | Abbas B.F., Khamis W.M., Abdullah A.M., Sha H., Environmental Pollution with the Heavy Metal Compound. Res. Journ. of Pharm. And Tech. 11(9)(0974-3618): 4035-4041. 2018. | ||
| In article | View Article | ||
| [23] | Othman R., Latiff H.N.M., Baharuddin Z.M., Closed Landfill Heavy Metal Contamination Distribution Profiles At Different Soil Depths And Radiuses. App Econ Environ Res. 17(4): 8059-8067. 2019. | ||
| In article | View Article | ||
| [24] | Samanta A., Bera P., Khatun M., Sinha C., Pal P., Lalee A. and Mandal A., An investigation on heavy metal tolerance and antibiotic resistance properties of bacterial strain Bacillus sp. isolated from municipal waste. J. Microbiol. Biotech. Res., 2 (1): 178-189. 2012. | ||
| In article | |||
| [25] | Ghosh A., Saha P.D., Bioremediation of Copper present in waste water using isolated Micro-organism Stenotrophomonas sp. PD2 from Soil of Dhapa, Kolkata, India. Elix. Poll. 47: 8921-8923. 2012. | ||
| In article | |||
| [26] | Saha A.,Santra S.C., Isolation and characterization of bacteria isolated from municipal solid waste for production of industrial enzymes and waste degradation. J of Microbiol. And Exp. 2014; 1(1): 12‒19. 2014. | ||
| In article | View Article | ||
| [27] | WEST BENGAL POLLUTION CONTROL BOARD. DHAPA DUMPSITE ENVIRONMENTAL AND SOCIAL ASSESSMENT REPORT. FEBRUARY. 2014. | ||
| In article | |||
| [28] | Giovannoni S.J., The polymerase chain reaction. In: Stackebrandt E., Goodfellow M. (eds) Nucleic acid techniques in bacterial systematics. Chichester,UK: Wiley, 1991, pp 177-203. | ||
| In article | |||
| [29] | Miller E.S., Woese C.R. and Brenner S., Description of the erythromycin producing bacterium Arthrobacter sp. NRRL Strain B-3381 as Aeromicrobium erythreum gen. nov.,sp. Nov. int. J of Syst Bacteriol. 41(3): 361-368. 1991. | ||
| In article | View Article PubMed | ||
| [30] | Schwyn B., Neiland JB., Universal chemical assay for the detection of siderophores. Anal Biochem 160: 47-56. 1987. | ||
| In article | View Article | ||
| [31] | Gordon S.A., Weber R.P., Colorimetric estimation of indoleacetic acid. Plant Physiol 26: 192-195. 1951. | ||
| In article | View Article PubMed | ||
| [32] | Rangarajan A., Kelly J.F., Iron bioavailability from Amaranthus Species: In Vitro dialysable iron for estimation of genetic variation. J Sci Food Agric 78: 267-273. 1998. | ||
| In article | View Article | ||
| [33] | Arnon D.I., Copper enzymes in isolated chloroplast. polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1-15. 1949. | ||
| In article | View Article PubMed | ||
| [34] | Chen Y.H., Shen Z.G., Li X.D., The use of vetiver grass (Vetiveria zizanioides) in the phytoremediation of soils contaminated with heavy metals. Appl Geochem 19: 1553-1565. 2004. | ||
| In article | View Article | ||